Отрефлексировать это: Недопустимое название — Викисловарь

Содержание

Мизогиния. Как полюбить женщину в себе и других?

1. Мизогиния по-русски — это женоненавистничество, непринятие женского начала, которое пропитывает нашу культуру. Если носительницами мизогинных взглядов являются женщины, то этот феномен называют женской мизогинией, либо усвоенной или внутренней. Он проявляется в двух форматах: во-первых, общее непринятие женского женщинами, во-вторых, представление о том, что женщина по какому-то критерию ниже мужского начала.

2. Мизогиния проявляется, когда одни женщины считают, что другие девушки попадают в плохие ситуации по своей вине. Это мнение часто ничем не подкреплено. Отсюда начинается виктимблейминг, слатшейминг и все остальное.

3. Мизогиния также рождается, когда у женщины все получается. Она сильная, смелая, добивается чего хочет, её не угнетают. А вокруг при этом женский мир состоит из слабости, нежности, проблем и угнетения. Тогда у сильной успешной женщины начинает возникать ощущение, что с остальными женщинами и поговорить не о чем. А их проблемы — не проблемы.

4. В женских журналах до сих пор многие пишут о том, что жизнь девушки должна крутиться вокруг мужчины. Именно она должна стараться, становиться лучше и спасать отношения. Это ставит женщину в положение, что она всем обязательно должна.

5. Один из первых корней мизогинии – социализация. Из СМИ, из родительства, из детства идёт, что девочка «должна». Активная девочка должна быть приятной, должна учиться ухаживать, заботиться, обслуживать, быть послушной и так далее. Многие девочки вырастают с пониманием, что мы — люди второго сорта.

6. Ответственность за эмоциональную сферу в любых отношениях, где ответственность несут двое, всегда возлагали на девочку. Это часто вызывает с одной стороны, ощущение уязвимости и страх что-то нарушить, а с другой, дополнительное чувство ответственности.

7. Ценность мужчины в российской и некоторых других культурах выше, чем женская. Рождение мальчика считается большей удачей, чем девочки. Отсюда и начинается мизогинность.

8. Мизогиния – это принижение и способностей женщин. И в результате этих принижений считается, что женщины недостаточно умны, точные науки не для них, что женщины скорее гуманитарии, не способны быть хорошими руководительницами, потому что эмоциональны. Это приводит к тому, что женщин дискриминируют.

9. В России сейчас идёт обострение гендерных тем, мы заговорили о феминизме и женском достоинстве. Это можно объяснить тем, что в своё время мы пошли путём советской эмансипации женщины. С одной стороны, женщин освободили и пригласили работать. С другой, работы стало больше, потому что патриархальный строй семьи никто не отменял. Поэтому в 1990 у нас случился мощный откат, когда девушки решили вновь поиграть в буржуазные роли, которые были запрещены в советское время. И только сейчас мы созрели для того, чтобы включиться в мировой процесс.

10. На протяжении долгого времени Западную культуру создавали мужчины. Женщины не имели возможности выражать свои мысли, участвовать в науке, общественной жизни. Получилось, что женщина подавалась изначально как недомужчина. И это до сих пор служит основой для многих гендерных стереотипов, даже не смотря на то, что сейчас женщины имеют право на образование и выражение своих мыслей.

11. Часто приходится слышать о том, что большинство художников, ученых, писателей и т.д. всегда были мужчины. При этом, не учитывается, что, во-первых, долгое время женщинам не разрешалось учиться. А, во-вторых, многим девушкам приходилось переодеваться в мужчин или подписывать свои труды мужскими именами, чтобы они были опубликованы. Также часто женские труды присваивались мужчинами, на которых те работали.

12. Различие между женской мизогинией и мужской. Первая всегда направлена вовнутрь себя, вовнутрь женщин. Получается, что женщина, которая принижает других девушек или как-то высказывается о них, разрушает (травмирует) и себя, даже если не осознаёт это. Мужчина же, если высказывается отрицательно о женщинах, он не травмирует себя, только других.

13. Женская мизогиния может приобретать разные формы. 1. Неприятие всего женского в целом, например, «все бабы — дуры». 2. Осуждение или обесценивание конкретных женщин. Со стороны это может выглядеть, как выражение собственного мнения. Если посмотреть вглубь, то можно увидеть, что осуждение происходит потому что другая женщина не соответствует каким-то нормам или эталонам. 3. Мимикрия или осознанная мизогиния, когда женщины добились каких-то хороших мест в мужской иерархии и начинают поддерживать мизогинные высказывания, чтобы не потерять своё положение.

14. Патриархально воспитанным женщинам сложно объяснять, почему другие женщины отстаивают свои права. Можно столкнуться с высказыванием: «Я же добилась всего, играя по-мужским правилам, тогда зачем мне права?».

15. Мужчине руководителю прощается больше ошибок, чем женщина руководительнице. В обществе каждый раз вызывает недоумение женское нежелание решать какие-то вопросы не через свою сексуальность.

16. Привычные стандарты, когда женщину ценят за то, что она украшение коллектива, хитрая, мягкая, кому-то должна подыграть или польстить – это проявление мизогинии.

17. Если говорить о требованиях к мужчинам и женщинам, то мы понимаем, что никто на работе не станет присматриваться к тому, в каком костюме пришёл мужчина. Все требования же к женщине имеют сексуализированный характер, и приводят к тому, что женщина рассматривается как объект.

18. Когда разговор заходит о женщинах, то появляется очень много стандартов красоты и ухоженности. Все они направлены в итоге на то, чтобы сделать девушек более уязвимыми для сохранения мужских привилегий. Например, все дозировки лекарств рассчитаны на среднего мужчину, а не на женщину. Женщины и существуют в этом мире будто только как украшение и сервис.

20. Мизогинные высказывания и установки делают женщин более уязвимыми к насилию. Существует двусмысленность: с одной стороны, женщина должна выглядеть привлекательно и сексуально для мужчины, а с другой, это провокация насилия. Необходимо понимать, что все эти навязанные стандарты красоты и сексуальности, это не наша природа, как часто можно услышать.

21. Для того, чтобы мизогинии в обществе стало меньше, необходимо спокойно и планомерно разрушать гендерные стереотипы. Гендерные стереотипы повсюду, стоит принять, что часть людей может перестать быть вашими друзьями, но для того, чтобы ситуация изменилась, нужно повторять и объяснять, не молчать и говорить, что, например, нет такой женской природы согласно которой она должна все прощать или терпеть. Это очередной стереотип. Ровно так же, что все женщины истерички. Единственный способ избавиться от мизогинии — это просвещать людей, говорить об этом. А ещё важно проанализировать собственное мышление, обратить внимание, где вы сами поддерживаете мизогинные высказывания и гендерные стереотипы.

22. Конкуренция между женщинами возникает из-за страха не соответствовать тем стандартам, которые существуют в обществе. Конкуренция — это миф, взятый из биологических наук 19 века, когда решили оценивать общество, как стаи животных, подразумевая, что именно благодаря конкуренции происходит развитие общества. Но на самом деле нейрофизиолог 20 века Анохин подтвердил, что живые системы выживают за счёт сотрудничества. Именно оно — эволюционный механизм, который поддерживает жизнь на земле.

23. Женщинам необходимо отказаться от конкуренции друг с другом. Потому что либо мы боремся за некое непонятно кем данное нам мужское признание между собой. Либо мы просто живем для себя, сконцентрировавшись на себе, несём центр в себе и развиваем свои уникальные потенции, свои возможности, не урезая себя кем-то когда-то придуманными стереотипами по поводу женственности и какой должна быть женщина.

Анастасия Воробьёва: «Главная цель мультфильма — отрефлексировать событие и помочь зрителю разобраться в случившемся»



В программе фестиваля очень большой блок отечественной анимации. Как думаете, с чем связан интерес к этому жанру?

Мне кажется, в мире происходит очень много событий, на которые люди пытаются как-то реагировать и переосмыслять их. Почти во всех видах искусства есть люди, которые помогают зрителю отрефлексировать эти события, анимация в том числе принимает участие в этом.

Правда, есть проблема. Сама по себе анимация делается очень долго, поэтому реагировать на события супер быстро бывает очень и очень сложно. И чтобы оперативно отрефлексировать явление и событие, нужно снимать либо очень быстро и не очень хорошо, либо супер коротко.

Почему документальная анимация становится популярной в России? Мне кажется, потому что в целом в России начали больше внимания уделять авторской анимации, и её открыли для себя обычные зрители. Вдобавок, наша анимация самобытна, и зрителю интереснее оценить наш опыт, нежели зарубежный.

В отличие от европейских коллег, мы используем и немного другие визуальные средства: чуть проще относимся к тому, как выглядит анимация. То есть для нас важно донести смысл, главная цель мультфильма — отрефлексировать событие, которое произошло недавно и помочь зрителю разобраться в случившемся.

Вы тоже делаете документальные мультфильмы, но они другие, в них повествование не от первого лица и даже есть интервью. Это документальная журналистика?

Первый документальный мультфильм, который я делала, он скорее более личный, потому что это было интервью с моей преподавательницей. И это скорее не журналистика, а более такой личный опыт. А вот второй мультфильм, он да, он на злобу дня.

Интересно, что вы назвали это журналистским опытом, вообще я не закладывала такого смысла. В документальный мультфильм я вкладываю свои собственные переживания, когда я хочу отрефлексировать какую-нибудь тему. И вот что-то сидит во мне, и я думаю, как же хочется что-то сделать с этим и отпустить это чувство… Я делаю мультфильм, и это помогает мне пережить событие и двигаться дальше.

Мои мультфильмы действительно не от первого лица, такой язык мне более близок. Я бы хотела сделать так, чтобы зрители видели не только мой опыт. Ведь когда герой размыт, тогда каждый может примерить опыт на себя.

Бесконечная насмотренность
Мультфильм основан на интервью преподавателя Школы дизайна — Анны Краснослободцевой. Она дала мне интервью про современное искусство, из которого я сделала короткую выжимку, и само интервью в мультфильме получилось довольно абстрактным. Там нет каких-то постулатов, что тоже интересно, потому что здесь документальная анимация перешла в разряд авторской. При этом она всё ещё остаётся документальной, потому что есть первоисточник — интервью. Мультфильм выполнен в технике живописи по стенам. Его я рисовала в подвале: каждый новый кадр рисовала на стене.

Меньше адидаса в кадре


Второй мультфильм про мою работу с одним русским рэпером. Когда я делала для него клип, в стране происходили тревожные события на рэп-сцене — концерты отменяли, рэперам запрещали гастролировать. Я хотела показать не только как я себя чувствовала во время работы, когда моего музыканта посадили (прим.ред. — за хулиганство), но и про то, что в целом происходит в этой индустрии, и насколько это страшно может быть. Но я не пыталась сделать из этого трагедию, посыл, скорее «это случилось, да, мы это прошли, идём дальше».

Почему коллажная техника? Чем она хороша для документальной анимации?

Коллаж вообще одна из моих самых любимых техник, потому что её сложно сделать плохо, даже если ты не умеешь рисовать, ты коллаж не испортишь. Картинки клеятся друг на друга, это действительно очень просто и подходит для начинающих аниматоров. Техника простая, но при этом понятная. Ты можешь использовать реальное изображение людей, немного изменять его, узнаваемый образ по итогу всё равно остается, и с ним можно работать.

Также она довольно быстрая. Зачастую именно документальная анимация использует коллажную технику, потому что она довольно быстро делается, и эффект от неё получается очень классным.

Мне вообще нравится совмещать элементы, у которых уже есть своя история. Изначально изображение уже носит какую-то свою историю, а когда ты её делишь и совмещаешь с другими, получается новая. Это тоже очень интересно.

Цех коллажной анимации. Как всё происходило, и можете дать пару советов для тех, кто хочет начать, но не смог посетить фабрику мультфильмов?

С участниками фабрики мы прошли весь путь создания мультфильма от начала до конца. Они придумали своих персонажей, придумали к ним действия, это очень важно, чтобы помимо персонажа, аниматор точно знал, какое действие будет совершать его герой. Мы сняли короткие сценки, совместили их большой мультфильм и оказалось так, что все придуманные персонажи находились на самом деле в одном пространстве.

Начинающим аниматорам круто начинать с насмотренности, бесконечной насмотренности: смотреть мультфильмы, и не только в коллажной технике, чтобы сформировать вкус, чтобы понимать, что сейчас делают режиссёры и к чему стоит стремиться.

Рекомендую скачать приложение на телефон называется Stop Motion Studio — кукольная мультипликация. Это программа, с помощью которой можно снимать мультики на телефоне. Всё очень просто: фотографируете каждый кадр и получаете мультфильм.

Над чем сейчас работаете, какие темы вам интересны?

Сейчас я работаю над мультфильмом про русский фольклор: про леших, водяных, такая тема. Очень хочется её изучить и популяризировать, ведь, как мне кажется, про эту тему мало кто знает. То есть фольклор мы знаем по сказкам, а мне бы хотелось сделать более глубокое исследование и понять, что было под сказкой? Во что древние славяне верили?

И, возможно, будет ещё один мультфильм про принятие себя через призму детской игры «секретики». Если помните, это когда ты всякие штучки закапываешь в землю и кладешь сверху стекло. И никто об этом не знает, это твой секретик. Хочу поработать с этим, с этой игрой. И это, кстати, тоже довольно русская штука, я не встречала такого явления в других странах.


Фото: Александр Паниотов/Культура24

«Сегодня каждому ребенку нужно помочь найти себя. И это как раз задача учителя».

27 октября 2021 года в рамках мастерской для учителей «Среда обучения» для победителей конкурса «Учитель будущего» прошла панельная дискуссия «Разные дети – общие подходы. Что общего между сложными и одаренными детьми?».

В мероприятии приняли участие:

  • Анастасия Ковалёва, руководитель сектора реализации и сопровождения проектов по профилактике безнадзорности и правонарушений несовершеннолетних Института воспитания РАО;

  • Ингрид Пильдес, директор Академии талантов Санкт-Петербурга;

  • Аделя Ахметова, заместитель директора Университета талантов города Казани.

Во время дискуссии Анастасия Ковалёва отметила, что сегодня важно помогать развивать таланты не только успешным в учёбе детям, а всем школьникам вне зависимости от их социального статуса:

«Сегодня каждому ребёнку нужно помочь найти себя. И это как раз задача учителя. Я всё время предлагаю учителю выделять у каждого своего ученика какой-то талант. Любой… И тем самым вы дадите всем ребятам почувствовать себя нужными и крайне важными в вашем коллективе».

«Очень важно создать эту ситуацию успеха… И наша задача, как наставника, вот это отрефлексировать, чтобы он понял, что он поднялся хотя бы на полступеньки, что у него это получилось. Чтобы у него появилась та самая мотивация, которая даст стимул ребёнку дальше двигаться»,

– добавила Ингрид Пильдес.

Также эксперты рассказали об успешных проектах развития детских талантов. Кроме того, во время дискуссии акцентировали внимание еще на одной современной проблеме – буллинге в школах, с которым сегодня часто сталкиваются многие дети и подростки. Анастасия Ковалёва поделилась с педагогами методами борьбы с травлей.

А уже 29 октября в рамках мастерской для учителей «Среда обучения» перед педагогами выступят заместитель директора Института воспитания РАО

Александра Снидко и ведущий научный сотрудник Института воспитания РАО Наталья Казначеева.

Смотрите прямую трансляцию на сайте средаобучения.рф – она доступна для всех желающих после предварительной регистрации на портале.

Фестиваль Любимовка — «Это всё — вымысел!», или «Пожалуйста, не оскорбляйтесь!»

Интервью с драматургом Фёдором Жельне

 

Дебютант «Любимовки» Фёдор Жельне — драматург из Санкт-Петербурга. Он написал монопьесу про утрату самого близкого человека — матери. Анастасия Ильина поговорила с автором о его тексте, личностном опыте и табуированных темах. 

 

 

Расскажи немного о себе: где ты учился и писал ли раньше пьесы?

 

Три года учился в Военмехе на ракетно-космическом факультете, потом отчислился и поступил в Институт кино и телевидения (СПбГИКиТ)на кафедру драматургии, этим летом выпустился и сдал экзамены в магистратуру той же кафедры. Это моя первая пьеса, я написал её в качестве курсовой работы у Константина Андреевича Фёдорова, он же посоветовал отправить текст на конкурсы драматургии. И вот я на «Любимовке», до сих пор не могу в это поверить, если честно.

 

Герой твоей пьесы в 21 год ощущает себя ребёнком, а потеря матери — трагический опыт, заставляющий его повзрослеть. Меня смутило слово «подросток» в описании пьесы. Что мы сейчас считаем подростковым возрастом: конкретные цифры или мироощущение? Для тебя принципиален возраст персонажа?

 

Я ничего в возраст не закладывал. Это история про большую ответственность, которая неожиданно сваливается на героя. В начале пьесы говорится, что он никогда не хотел быть ответственным человеком, но ему приходится им стать. Это путь, который его меняет.

 

Поговорим о жанровой принадлежности этой пьесы. Построение текста напоминает монолог в жанре стендапа.

 

А если бы там были три человека, вы бы сказали, что это стэм [игровой конкурс в КВН, где на сцене одновременно могут находиться не более трех человек — прим. ред.]? Для меня это комедийный моноспектакль, в котором, конечно, есть часть приёмов из стендапа. Но можем ли мы говорить, что это чистый стендап только потому, что шутки говорит один человек? Я определил для себя жанр как драмеди-моноспектакль. А дальше — всё на откуп режиссёру или актёру. Может, это вообще блюз.

 

Есть ли в этой истории автобиографические мотивы или она никак не пересекается с твоим опытом?

 

Это история во многом основана на реальных событиях. Я бы ещё добавил «никто не пострадал», но это неправда. Комедия – это трагедия плюс время. Прошло три года, и я смог это отрефлексировать свою историю. Раньше смеяться было нельзя, хотя порой хотелось, а сейчас уже можно. 

 

То есть в форму пьесы ты заключил свой опыт?

 

Да, я обнаружил, что про смерть родителей никто в театре не рассказывает, но все почему-то всё знают. Кроме меня. Такие темы очень стигматизированы, публично никто не пишет про них, хотя, кажется, это полезно. И я решил про это поговорить.

 

На «Любимовке» существует система распределения пьес среди режиссеров, которые ставят читки. Как у тебя произошла встреча с режиссером?

 

В этом смысле я плохой пример. Из тех, кого я хотел видеть режиссером своей пьесы, никого не оказалось в афише рядом с моей фамилией.  Надеюсь, у Артема Дубра всё получится. Он меня выбрал или я ему достался по какому-то принципу, не знаю. Понимаю, почему режиссеры не хотят брать эту пьесу: один актёр, значит, не развернуться.

 

Ты думал о том, каким должен быть актёр, исполняющий этот текст?

 

Он должен понимать комедийное построение текста: где нужно сделать паузу, посмеяться или поплакать. Очень важно вначале вкатиться в эту историю и позволить себе смеяться. Как только это произойдет, дальше всё будет хорошо. Не важны даже возраст и гендер актёра. 

 

Какие у тебя ощущения перед читкой? Волнуешься?

 

Да, немного. Я не представляю, что там будет и как меня будут воспринимать люди. Может быть, скажут, что я богохульник, зачем про всё это говорю с таким неуважением. Или, наоборот, все поймут, что речь о большой любви. Смогут ли меня отделить от персонажа? Ведь он все-таки гиперболизированная версия меня.

 

Были прецеденты, когда зрители в театре оскорблялись из-за табуированности поднимаемых тем. Есть вероятность, что твой текст способен кого-то оскорбить?

 

Нет, я так не думаю. В пьесе всё довольно органично обрамлено, чтобы никого не задеть. Но такая ситуация может произойти несмотря на то, что я утверждаю: это — вымысел. Это всё — вымысел! Пожалуйста, не оскорбляйтесь!

 

Редактор: Александр Рубцов

Фото: Юрий Коротецкий и Наталия Времячкина

Фестиваль Любимовка — «Я ставлю точку, и это больше не моя история»

Интервью с драматургом Милой Фахурдиновой

 

Мила Фахурдинова второй раз вошла в шорт-лист фестиваля «Любимовка». Её пьеса «Нож, которым я копаюсь в себе» лишена гендера. Текст драматурга в этот раз касается темы, о которой больно и не принято говорить, — насилия.

 

 

Про свою дебютную пьесу «Голая», которая была представлена на фестивале в 2018 году, вы говорили, что она автобиографична. Насколько документальна новая пьеса?

 

Текст на 100% обо мне. Это документальная история, достаточно интимная, но было важно отрефлексировать ситуацию без гендера. Мы много говорим о мужском насилии, но насилие не имеет пола. Есть насилие мужчин в отношении мужчин и женщин в отношении женщин. У меня был опыт нахождения с обеих сторон: я попадала в абьюзивные отношения, и сама была абьюзером, где-то испытывала чувства я, а где-то — ко мне. Люди, с которыми я взаимодействовала, тоже были и жертвами и абьюзерами. Для меня написание пьесы — своего рода терапия: с «Голой» я проживала один период жизни, а с этой историей — другой.

 

Почему вы выбрали форму интернет-переписки?

 

Мне нравится, когда в пьесе не описаны действия. Это пространство для творчества режиссера. Когда работала над пьесой, читала несколько переписок с похожими ситуациями — две своих и одну моего хорошего приятеля. Изучив их, поняла, что хочу сохранить форму. Написала текст, а затем выправила все половые маркеры в репликах героев.

 

Сокращался ли текст пьесы по сравнению с тем, что вы написали изначально?

 

Сейчас пьеса представляет собой треть написанного. Сначала всё, что я хотела сказать, составило более 60 страниц.

 

А что для вас значит быть настоящим драматургом?

 

Посвятить жизнь театру, быть вовлечённым, высказываться обо всём, а не только о личном.

 

Было ли желание стать режиссёром собственной пьесы?

 

Нет, я давно отказалась от театра. Меня как режиссёра не устраивает зависимое положение от других людей. Можно репетировать с актёрами 3 месяца, а потом на выступлении спектакль развалится. Я к этому не готова, поэтому кино мне ближе.

Хотелось ли вам что-то поменять в уже готовом тексте?

 

Я завершила пьесу в октябре 2020 года, и с тех пор её не перечитывала. Всех подробностей текста уже не помню. Для меня отпускать текст — важный элемент психологической защиты. Я не перечитываю свои пьесы и не пересматриваю свои фильмы. Бывает достаточно сложно, когда в критике тебя обсуждают так, будто ты и есть фильм. Поэтому я для себя решила, что как только завершаю текст, он уже не мой. Ставлю точку, и это больше не моя история.

 

Какие у вас ощущения от предстоящего обсуждения пьесы?

 

Волнительно. Этот текст, как и предыдущий, очень личный. Читка — хорошее завершение непростой истории.

Как драматург я ничего не жду. Вместе с тем, интересно, что скажут люди.

 

У вас уже есть мысли о следующей пьесе?

 

Да, начну её писать в октябре. Сейчас такой период жизни, когда я очень вовлечена в общение с друзьями. Многие современные москвичи не стремятся обзавестись семьями, а создают семью из друзей. Возможно, из этого возникнет не пьеса, а сценарий или сериал.

Как аффилированные компании «Филип Моррис Интернэшнл» развивают инновационную культуру? Рассказываем в 6 шагах

Какие барьеры стоят перед крупными компаниями в развитии инноваций? Какие шаги помогут с ними справиться? Почему смелые эксперименты экономят ресурсы? Как, несмотря на вечную перегруженность работников корпораций, находить на это всё время и внедрять инновационную ДНК в коллектив?

Ответами на эти вопросы и советами поделилась с ИКРОЙ Татьяна Иванова — управляющая по организационной эффективности аффилированных компаний «Филип Моррис Интернэшнл» (ФМИ) в России.


Шаг 1. Зачем вам инновации?

В нашей компании внедрение инновационных подходов началось несколько лет назад, когда ФМИ в России запустили новую категорию продукта на рынок. Тогда стало понятно, что нужно сокращать цепочки согласования внутри компании, чтобы процессы двигались быстрее. Как раз в этот период началась активная внутренняя трансформация, важной частью которой стало внедрение новых подходов к работе. 

Так появился FAST FORWARD — клиентоориентированный подход, который заключается в быстрой выработке гипотез и проведении экспериментов, чтобы найти успешные решения проблем клиентов и решить бизнес-задачу.

FFWD — это принципы и инструменты, которые позволяют при поиске решений «говорить на одном языке» внутри компании, где единица учета — проверенные гипотезы. Так мы начали постепенно внедрять в компанию культуру экспериментов.

Я бы посоветовала компаниям, которые хотят внедрять инновационные подходы, начать с проработки двух вопросов:

  • Зачем вы это делаете? 
  • Что значат инновации конкретно для вашей компании?

Шаг 2. Что такое инновации для вас и для других компаний?

Для меня инновации — это любое новшество, которое позволяет зарабатывать больше, упрощать процессы, быстрее и эффективнее достигать результатов, делать доступными многие вещи для широкой аудитории, а также улучшать качество жизни. Речь идет не только об изобретениях, но и об образе мышления. Прежде всего необходимо понимать, почему вам это необходимо?

В прошлом году мы решили рассматривать инновации более комплексно и начали с вопроса:

«А что такое инновации для ФМИ в России? И в каком направлении мы хотим двигаться в этом вопросе?»

Следом решили пообщаться с внешним рынком и понять, как другие компании развивают инновации. Во время исследования мы поняли, что для одних это — Илон Маск, для других — просто отказ от Excel и запуск автоматизированной платформы.

Тогда мы подумали, что нужно сформировать собственное определение инноваций и определить ключевые направления развития. Для решения этого вопроса мы организовали «Инновационную неделю»: в течение нескольких дней 15 внешних спикеров из разных индустрий в формате живой дискуссии делились собственным подходом к инновациям с расширенной управляющей командой аффилированных компаний ФМИ в России. Так мы почерпнули интересные инсайты, которые помогли нам определить собственные направления для развития инноваций.

Шаг 3. Как отрефлексировать полученный опыт и какие программы могут в этом помочь?  

Затем случилась стратегическая сессия, которую мы проводили совместно с ИКРОЙ. 

Цель:

Рефлексия на тему собранных инсайтов «Инновационной недели» и адаптация под бизнес-контекст ФМИ в России.

Что делали:

Управляющая команда аффилированных компаний ФМИ в России изучили тренды, разобрали инновационные подходы различных функций и искали возможности развития инноваций в компании. Определяли мотивы и барьеры, учились разрешать их, предложили множество идей. Затем соединяли потенциальные возможности с ключевыми фокусами, кластеризировали и приоретизировали их.

Итог:

За 2 дня мы определили 4 основных направления развития инноваций, взяли их за основу для следующего этапа и презентовали расширенной управляющей команде. Так мы сфокусировались на том, что для нас действительно важно в течение ближайших 2-х лет.

После у нас была сессия Innovation Sandbox, которую мы также провели с ИКРОЙ
Участники — расширенная менеджмент-команда (extended management team) — 120 человек.

Цель:

Разработать конкретные решения в рамках 4-х направлений развития инноваций.

Что делали:

Руководители различных функций аффилированных компаний ФМИ в России предлагали тактические решения и методы реализации по развитию инноваций в компании. Рассматривали примеры успешных кейсов; искали барьеры, составляющие дерево нежелательных явлений, и возможные решения для преодоления этих барьеров, разрабатывали план действий.

Итог:

Мы выбрали 6 основных идей, которые ушли в дальнейшую проработку. Сейчас эти идеи трансформировались в большие кросс-функциональные проекты, которые реализуются расширенной управляющей командой аффилированных компаний ФМИ в России. Кроме того, эти команды продолжают путь развития и погружения в использовании креативных и клиентоцентричных инструментов.

«

Нашей главной задачей было сформировать у команды менеджмента инновационную ДНК»

Самое важное, что отметили участники — после программы они вышли не просто вдохновленные, а с конкретными решениями. Удивительно, но за 3 часа можно придумать не одну классную идею, а целый список, из которого можно выбирать. 

Второй важный момент связан с донесением идей до ключевых стейкхолдеров. Мы попробовали формат питчинга — коротких выступлений на 3 минуты — и за это время у участников получилось донести главную мысль их идей. 

Шаг 4. Как работать с барьерами в мышлении сотрудников?

Самое сложное — бороться с возражением «у нас очень много проектов». И здесь наша задача донести, что мы предлагаем новые подходы для достижения существующих целей. 

Второй барьер связан с культурой ошибок. Базовый элемент в корпоративной культуре, который делает организацию гибкой — это культура ошибок, или способность компании из ошибок делать опыт. Основная задача культуры ошибок — дать сотруднику четкую установку: когда есть выбор между ошибиться и действовать, нужно выбирать — действовать. Мы начали внедрять такую культуру вместе с FFWD несколько лет назад и до сих пор нам еще есть над чем поработать.

Стоит начинать с проработки культуры в компании, это первостепенно. Инновации происходят там, где начинает меняться майндсет сотрудников. А компания параллельно с этими изменениями должна работать над тем, чтобы обеспечить необходимым инструментарием свою команду.

Шаг 5. Какие методические инструменты полезно внедрить в работу для создания инновационной среды?

Теория ограничения систем

В бизнесе часто возникают вызовы, которые нужно решать быстро — и в этой ситуации легко взяться за поверхностную ошибку, не заметив основной проблемы. Большой плюс Теории Ограничения Систем в возможности докопаться до этой самой корневой проблемы. 

Латеральное мышление и ТРИЗ

До взаимодействия с ИКРОЙ ключевым инструментом генерации идей был классический брейншторм. Он, конечно, не всегда дает нетривиальные решения. А вот, например, инструменты латерального мышления в сочетании с ТРИЗ позволяет создать действительно новое решение. 

Шаг 6. Как оценить влияние всех программ и действий компании по развитию инноваций?

Я думаю, если мы сейчас начнем ставить KPI, то будем загонять себя в рамки и действовать как раньше. Сейчас мы пробуем разные инструменты, и методики креативного мышления — это только часть из них. Мы будем оценивать инновационную активность, которую начали в прошлом году, по результатам проектов. 

«

На мой взгляд, нужно начинать не с того, как вы будете достигать, а с того, чего вы хотите достичь. Далее следует понять, что для вашей команды означает слово Инновации. И здесь нет правильного или неправильного определения. Для всех оно будет разным». 

Рецензия на сериал «Номинация»: сестры Михалковы рассказали, каково жить в тени знаменитого отца

Нужно, наверное, быть весьма отважными и ироничными людьми, чтобы отрефлексировать собственные комплексы в целое сериальное полотно. Надежда Михалкова, дебютировавшая как режиссер сериального жанра, написала сценарий этой истории, сыграла одну из главных ролей, а на вторую позвала сестру Анну. По сюжету героини — тоже сестры, тоже актрисы и тоже дочери выдающегося, известного на всю страну, режиссера и кинодраматурга. Правда, уже покойного. Окружающие нет-нет, да и намекнут: «Ты хоть что-нибудь сделала сама? Чтобы отец тобой гордился?». Впрочем, про Татьяну, героиню старшей Михалковой, говорят: «Хорошая актриса» — как и про саму Анну в реальной жизни. А вот младшая Вера (Надежда Михалкова) вся во фрустрациях, а посему нервна, жестка и неразговорчива. Нет, она иногда говорит, но это как раз тот случай, когда лучше бы помолчать.

Кадр со съемочной площадки сериала «Номинация»

Начинается «Номинация» с кадров видеоинтервью Веры Истоминой. Томно закатывая глаза, наследница великой фамилии — холодная стерва с алой помадой на губах, трижды за короткий монолог называет Россию «эта страна», попутно развешивая оплеухи коллегам: «Будущего нет, потому что индустрии нет. То, что они снимают, сами не смотрят. Вкус у них есть – только снимают одно, а смотрят другое… Современное кино – это не про талант, а про скорость. Пытаются быстрее снять, потому что ипотека, или домик у моря купить хочется»… Главный месседж героини: кино здесь снимать не умеют, а посему «я уезжаю по приглашению в Голливуд и возвращаться не намерена». Снобизм (или честность?) Истоминой не проходит для нее даром — индустрия, увидев интервью, вносит актрису в черные списки: «Возьмешь ее – а она потом обо…т на всю страну. Берем Куропаткину». Но и контракт с Голливудом по какой-то причине расторгается. Вера остается у разбитого корыта, злая и обиженная на весь мир. Ее сестра тем временем, не щадя живота своего, скачет из сериала в сериал, пытаясь честно выдавливать из себя человеческие эмоции, снимаясь в окопах, или изображая императрицу в пышном парике, кричащую: либо «Проклятая страна!», либо «Утопить – как пуделя!». Ей хочется играть драму драмскую, она действительно способна придать глубокий смысл любой своей роли, но ведь не предлагают достойный материал.

Кадр со съемочной площадки сериала «Номинация»

Есть в этом неблагополучном семействе (даром, что носят громкую фамилию) еще и мама – пожилая женщина с гоголевским именем Агафья, правда, Александровна (Людмила Максакова). Она носит жемчуга, канотье, светлые костюмы, имеет любовника (Владимир Мишуков), удочерила девочку, в общем, живет насыщенной жизнью. Но главное – она руководит Фондом имени покойного мужа. НКО по идее должна заниматься производством и продюсированием кино. Должна — но не занимается. Однажды журналисты раскопают, что выделенные госсредства Фонд получил, а патриотический фильм «Единственная» так и не снял. Разразившийся скандал грозит обернуться потерей репутации для всего звездного семейства, а также крахом Фонда. Женщины решат объединиться, чтобы снять-таки злосчастный фильм. Для проштрафившейся и амбициозной Веры это шанс показать, что такое качественное кино – она садится в кресло режиссера. Анна как актриса пытается вытянуть на себе женскую роль. Однако изучение сценария «Единственной» приводит к горькому выводу: это кино обречено — его не спасет ни монтаж, ни наложенная душераздирающая музычка, ни красивые пейзажи (на которые, кстати, нет денег). И тут как черт из табакерки возникает старый отцовский друг-соавтор и предлагает последний сценарий Истомина – гениальный как всегда. Место действия — Север, жанр — притча, герои — старики и молодые, первые должны по какой-то старой традиции принести в жертву вторых. Если с умом за такое взяться, может получиться шедевр, претендующий на какую-нибудь номинацию крутого международного киносмотра…

Кадр из сериала «Номинация»

Сериал у Надежды Михалковой вышел неровный. Местами прям чувствуешь действительно личную интонацию – все эти нанесенные обществом обиды про «на детях великих», про «яблоню и яблоки», все эти собственные переживания и комплексы – «а смогу ли когда-нибудь подпрыгнуть и дотянуться до творчества папы». Есть, например, в сериале такой монолог героини: «Люблю старое кино. Папино кино… Хочется уехать во Францию… Здесь ты еще ничего не сделал, а тебя уже любят или ненавидят». Но эта личная интонация то и дело пропадает, сериал сбивается с ритма, начинает грешить ненужными подробностями и банальными диалогами (особенно по части прописных истин отличает друг-соавтор покойного отца).

Конечно, проект, заточенный на то, чтобы рассказать о том, как в наших палестинах снимается кино (особенно, в отсутствии денег) не обходится без ироничного взгляда на современную индустрию. Нам, например, показывают идиота-инвестора (Игорь Миркурбанов), пропихивающего на роль свою любовницу. Показывают 27-летнего режиссера, который проводит презентацию ретроспективы своих фильмов – целых двух. На афише последней картины красуются лица явно не титульной нации, и закрадывается невольная мысль: кто же этот режиссер? Не Кантемир ли Балагов со своей «Теснотой»? Вера Истоминова, напившись в хлам, кричит более успешному коллеге: «У моего отца первая ретроспектива случилась в 50 лет. Он снимал честное кино, а ты повесточку осваиваешь? Нацменьшинства, геи, кровавый режим, продажные священники»… Таких крючочков в реальность в сериале немного: в кадре появляется еще Сергей Минаев, берущий интервью у Агафьи Александровны, тележурналист Иван Кудрявцев, проводящий презентацию фильма… Лично я ждала фейерверка имен и камео, беспощадного портрета индустрии, чего-то смешного в духе Григория Константинопольского или «Домашнего ареста» Буслова иСлепакова. Я думала, придется сидеть и разгадывать, как в книжке Валентина Катаева «Алмазный мой венец» или скандальной повести Татьяны Егоровой «Андрей Миронов и я», над кем из реальных деятелей стебется автор. Но пока в первых двух сериях (оставшиеся две покажут 9 и 10 февраля) никого особенно и не задели. Есть, правда, сцена, когда героиня Анны Михалковой, мечтающая ездить со своими работами по международным фестивалям, напрашивается на пробы к «Осипову-младшему». Она вся трепещет, волнуется, выдает просто фантастическую органику на пробах. И что слышит в ответ от режиссера? Длинные пространные философствования, смысл которых «не в этот, Таня, раз», и предложение почитать толстую книгу о его прошлом проекте. Кого Надежда Михалкова выводит под образом Осипова-младшего? Кто у нас из «младших» отличается тягой к размышлизмам? Герман? Бондарчук? Решайте сами.

Ольга Остроумова в сериале «Номинация»

«Номинация» пытается «врезать» и адептам «патриотического кино», которое снимается по одним и тем же лекалам, и одновременно либералам от индустрии – за стремление искать глубинные смыслы там, где их нет. Но все эти шутки вводятся в сериал время от времени, и ты теряешься в догадках, что за жанр избрала Надежда Михалкова? На сатиру не тянет, а для драмы – слишком много отвлекающих линий.

На презентации проекта режиссер говорила, что это кино о семье, о том, что у каждого есть братья и сестры, и их взаимоотношения интересно препарировать. В «Номинации», если и анализируются семейные отношения, то только в контексте токсичной матери Агафьи Александровны, которая привыкла управлять всеми, держать все под контролем. Однажды она держала под контролем здоровье и жизнь мужа – и приняла решение о том, чтобы отключить его от систем жизнеобеспечения, когда врачи уже не давали Истомину шансов. Этого-то младшая дочь и не может простить ни матери, ни себе.

Людмила Максакова в сериала «Номинация»

Людмиле Максаковой не впервой играть «кровавую барыню» (привет «Му-му» Юрия Грымова). Тем более и антураж подходящий: ее героиня живет в роскошном загороднем доме, похожем на дачу на Николиной горе. Дом обставлен предметами роскоши – вазы, канделябры, зеркала, старинная мебель и даже картина, «подаренная Тонино Гуэрра». Все это пиарщики посоветуют хозяйке убрать с глаз долой – перед видеоинтервью, дабы не раздражать народ. Но журналистов и народ не обманешь – они и так знают, о том, как живут у нас представители известных династий. И в чем искать спасения от этой тотальной лжи и фальши, как бы спрашивает режиссер Надежда Михалкова? И отвечает: в настоящей жизни и в настоящих людях. Загнанные безденежьем в угол сестры Истомины едут на кастинг в Дом ветерано кино, и там видят подлинных Творцов — готовых на все ради роли, не привыкших осваивать бюджеты. Эпизод, который выносит на своих могучих плечах Ольга Остроумова, действительно пробивает до слез. И если и хочется продолжать смотреть этот сериал — то ради того, чтобы увидеть, что же ждет ее героиню.

Надежда Михалкова поставила перед собой сложную задачу — одновременно высказаться и о семье, и об индустрии, и о своем месте в искусстве. В «Номинации» реальность переплелась с вымыслом в такой тугой узел, что уже непонятно, где выстраданное, пережитое, а где сарказм и глумление. Легко и весело говорить о том, как не надо снимать кино. Показать, как надо — гораздо труднее. Посмотрим, удастся ли это автору в оставшихся двух сериях.

Смотрите мини-сериал «Номинация на ОККО с 7 февраля

Шарнирное зеркало Reflect-It™

Шарнирное зеркало Reflect-It™

Магазин не будет работать корректно в случае, если куки отключены.

Похоже, в вашем браузере отключен JavaScript. Для наилучшего взаимодействия с нашим сайтом обязательно включите Javascript в своем браузере.

  • Дома
  • Зеркало Reflect-It™ на петлях

Пролейте немного света на отражения и симметрию, используя зеркальные материалы!

Отражения, переводы и симметрия легко увидеть и понять с помощью практических занятий, в которых используются зеркальные материалы из этого набора! Включает навесное зеркало Reflect It с основанием транспортира, гибкие зеркала, подставки для зеркал и пластиковые зеркала двух размеров.

Что включено:

  • 1 Шарнирное зеркало Reflect-It
Уровень 4, 5, 6, 7, 8, 9, 10, 11, 12
Артикул № 5035
Наличие Да
Размеры (Д х Ш х В) 22.8″ х 12,7″ х 10,5″

Мы нашли другие товары, которые могут вам понравиться!

Зеркало на шарнирах Reflect-It для классной комнаты

Зеркало на шарнирах Reflect-It для классной комнаты

Магазин не будет работать корректно в случае, если куки отключены.

Похоже, в вашем браузере отключен JavaScript. Для наилучшего взаимодействия с нашим сайтом обязательно включите Javascript в своем браузере.

  • Дома
  • Зеркало на шарнирах Reflect-It для классной комнаты

Набор включает 30 зеркал на шарнирах Reflect-It и 72-страничную тетрадь, посвященную углам, отражениям, поворотам, перемещениям, симметрии и свойствам многоугольников, и все это в пластиковой сумке для хранения.

Что включено:

  • 30 зеркал на петлях Reflect-It
  • Рабочая тетрадь
  • Сумка для хранения
Уровень 4, 5, 6, 7, 8
Артикул № 77926
Наличие Да

Светоотражающая линия гамаков Catzye™ | Лайтсмит

  • Работает как AmSteel®-Blue или Lash-It/Zing-It
  • Светоотражающие трассеры светят ночью
  • Очень малорастяжимое, сверхлегкое, но очень прочное волокно Trevo™ UHMWPE
  • Более плотная 12-прядная конструкция
  • Идеально подходит для строп и хребтов

 

Catzye™ изготовлен из сверхвысокомолекулярного полиэтиленового волокна Trevo™ (UHMWPE).Тот же тип волокна, что и для Dyneema® или Spectra®. Trevo сверхпрочный и имеет очень низкое растяжение , что делает его идеальным для строп гамака, UCR и хребта.

Так чем же он отличается от AmSteel-Blue или Lash-It/Zing-It? ….. светоотражающие трассеры . Направьте свет на линию, и трассеры отразят его обратно. Конечно, легче увидеть свой гамак ночью или собраться в темноте, ничего не забыв. легко сращивается , а более плотная 12-прядная конструкция делает его более устойчивым к зацепам , чем 8-прядный AmSteel-Blue или Lash-It/Zing-It.Catzye имеет полиуретановое покрытие, благодаря которому леска изнашивается дольше и держит узлы намного лучше, чем лески Spectra без покрытия.

Леска диаметром 2,8 мм (~7/64 дюйма) имеет более чем достаточную прочность для подвесных строп и UCR. Леска 1,8 мм (~1/16 дюйма) отлично подходит для хребта, но недостаточно прочна для подвески.

Catzye доступен длиной 25, 50 или 100 футов (7,6, 15,2 или 30,5 м).

Trevo производится компанией DSM Dyneema. И Trevo, и Dyneema представляют собой волокна из сверхвысокомолекулярного полиэтилена с очень похожими свойствами.Вплетенная в леску, Catzye (Trevo) работает как AmSteel-Blue или Lash-It/Zing-It (Dyneema) для использования в гамаке.

 

Сравнить Кэтзи Lash-It/Zing-It Кэтзи AmSteel-Blue
     Диаметр 1,8 мм (~1/16 дюйма) 1/16 дюйма  2,8 мм (~7/64 дюйма) 7/64 дюйма
    Прочность на разрыв

675 фунтов (306 кг) мин.

708 фунтов (321 кг) в среднем

500 фунтов (230 кг) в среднем

1430 фунтов (649 кг) мин.

1500 фунтов (681 кг) в среднем

1400 фунтов (650 кг) мин.

1600 фунтов (730 кг) в среднем

    Пряди 12  12 8
    Светоотражающие трассеры ✔     

  

 

Технические характеристики

Длина : 25, 50 или 100 футов (7.6, 15,2 или 30,5 м)

Материал : Предварительно растянутое волокно Trevo™ UHMWPE (например, Dyneema или Spectra)

Покрытие : Полиуретан

Конструкция : 12 нитей (11 нитей UHMWPE, 1 нитка светоотражающих трассеров)

Светоотражающие трассеры : 1

Цвета : черный, темно-серый или оранжевый

Диаметр* Хорошее применение Предел рабочей нагрузки** Прочность на разрыв Вес / фут Вес/м
1.8 мм (~1/16 дюйма) Риджлайны

135 фунтов (61 кг)

675 фунтов (306 кг) мин.

708 фунтов (321 кг) в среднем

0,031 унции (0,87 г) 0,100 унции (2,84 г)
2,8 мм (~7/64 дюйма) Слинги Вупи

286 фунтов (130 кг)

1430 фунтов (649 кг) мин.

1500 фунтов (681 кг) в среднем

0.058 унций (1,64 г) 0,190 унции (5,39 г)

*Изготовлены для метрических диаметров, указанные размеры в дюймах являются ближайшими эквивалентами. **WWL основан на 5-кратном расчетном коэффициенте (DF). МБС/ДФ=WLL. N не рекомендуется для подвешивания медвежьего мешка, так как на кору могут быть нанесены светоотражающие элементы.

 

  • НЕ используйте в ситуациях, когда может возникнуть угроза личной безопасности или ценному имуществу.
  • Проверяйте перед каждым использованием. НЕ используйте, если есть явные признаки износа, такие как порезы, сломанные волокна, распускание, истирание, обесцвечивание или другие признаки износа. При воздействии прямых солнечных лучей и внешних элементов может произойти ухудшение качества.
  • НЕ превышайте рабочую нагрузку. При использовании в динамических условиях (нагрузка, рывок) необходимо соблюдать дополнительную осторожность. Эти условия могут снизить рабочую нагрузку на целых 33%.
  • По возможности избегайте использования узлов; сращивание предпочтительнее.Узлы снижают прочность каната до 50%.
  • ЗАПРЕЩАЕТСЯ стоять на одной линии с натянутой веревкой; он может неожиданно отскочить (отскочить назад), если его отпустить или сломать.
  • НЕ ИСПОЛЬЗУЙТЕ для крепления больших плоских предметов, которые могут подняться или сместиться из-за повышения давления воздуха под ними.
  • Неправильное использование может привести к серьезной травме или смерти.

Ни при каких обстоятельствах Litesmith, LLC не несет ответственности за любой прямой, косвенный, штрафной, случайный или особый последующий ущерб имуществу или жизни, возникающий в результате или связанный с использованием или неправильным использованием ее продуктов.

границ | Транскриптомные ответы Rhizobium Phaseoli на корневые экссудаты отражают его способность колонизировать кукурузу и фасоль обыкновенную в системе совмещения культур

Введение

Сопутствующие культуры кукурузы ( Zea mays ) и фасоли обыкновенной ( Phaseolus vulgaris ) широко использовались в сельском хозяйстве Мезоамерики на протяжении тысячелетий. Эти сопутствующие культуры называются «милпа» (от слов на науатле: «милли», что означает возделываемый участок, и «пан», что означает «над») (Rodríguez-Robayo et al., 2020). Часто включают тыквенные растения, а также другие виды растений; однако они не находятся в такой тесной связи, как с кукурузой и фасолью (Lopez-Ridaura et al., 2021). Фасоль обычно взбирается на кукурузу, а вьющаяся фасоль имеет длинные циклы, аналогичные циклам кукурузы, и была определена как обладающая высокой азотфиксирующей способностью по сравнению с кустовыми растениями P. vulgaris , которые используются в монокультуре. Системы Milpa имеют большое сельскохозяйственное значение для фермеров, поскольку они обеспечивают большой объем продовольствия на единицу площади и рацион, богатый питательными веществами, витаминами и биологически активными соединениями (Méndez-Flores et al., 2021; Новотный и др., 2021). В поликультуре кукуруза дает более высокую урожайность с растения, чем в монокультуре, и каждое растение фасоли дает такую ​​же или более высокую урожайность в зависимости от посаженного сорта (Santalla et al., 2001; Zhang et al., 2014). Дополнительные исследования показали, что у милпа использование почвы более эффективно, чем у монокультуры (Aguilar-Jiménez et al., 2019). Причина этого заключается в том, что у кукурузы более глубокая корневая система, чем у бобов, что позволяет милпам исследовать больший объем почвы для поглощения питательных веществ и воды (Albino-Garduño et al., 2015). Совмещение кукурузы и фасоли также более эффективно в борьбе с болезнями и насекомыми-вредителями (Fininsa, 1996), а плодородие почвы сохраняется лучше, чем при выращивании монокультур (Alfonso et al., 1997).

После Зеленой революции примерно в 1940–1970 годах, с появлением удобрений, увеличением ирригации, гербицидов, гибридных сортов и механизации кукурузу и бобы начали выращивать как монокультуры во многих местах, особенно на крупных фермах (Агилар- Хименес и др., 2019).Использование земли в монокультуре привело к деградации почв и зависимости от внешних ресурсов. Если бы в системе milpa возделывалось больше земли, можно было бы восстановить биоразнообразие, богатство почв и использование разнообразных местных сортов, подходящих для milpa.

Изучена микробиота почв, где выращивается милпа в разных районах Мексики, при этом наиболее распространены Proteobacteria, Actinobacteria и Verrucomicrobia (Rebollar et al., 2017; Aguirre-von-Wobeser et al., 2018; Гастелум и Роша, 2020 г.). Растущие вместе, с переплетенными корнями, кукуруза и фасоль могут иметь общую микробиоту в milpa. Мы предположили эту возможность и искали ризобии в растениях кукурузы, связанных с фасолью. Мы обнаружили ризобии в виде естественных эндофитов кукурузы внутри стеблей и корней (Gutiérrez-Zamora and Martínez-Romero, 2001). Среди бактерий, ассоциированных с растениями, ризобии заслуживают особого внимания из-за их способности индуцировать образование корневых клубеньков бобовых, где ризобии осуществляют фиксацию азота после дифференцировки в бактероиды.Популяционный анализ ризобий кукурузы показал, что штамм R. Phaseoli Ch34-10 (далее названный Ch34-10) принадлежал к группе бактерий, в изобилии встречающихся в растениях кукурузы (Rosenblueth and Martínez-Romero, 2004), поэтому мы выбрали Ch34- 10 для дальнейшего изучения. В фасоли Ch34-10 проявляет высокую способность связывать азот, как и штамм R. Phaseoli CIAT 652. Однако в CIAT 652, который используется для коммерческого производства инокулянта, отсутствует плазмида, кодирующая гены использования углеродного субстрата, поэтому Ch34 -10 может быть лучшим для колонизации растений.

Азотфиксация бобовыми способствует значительному поступлению азота в сельское хозяйство, а также в естественную среду обитания, и желательно распространить азотфиксацию на злаки (Rosenblueth et al., 2018). Хотя кукуруза не образует клубеньков, экссудаты кукурузы стимулировали клубенькообразование ризобий и фиксацию азота конских бобов ( Vicia faba ) за счет усиления экспрессии корневых генов бобовых, участвующих в синтезе флавоноидов, передаче сигналов ауксина и процессе образования клубеньков (Li et al., 2016). Лучшее образование клубеньков и усвоение питательных веществ также наблюдалось у кукурузы, связанной с фасолью (Cardoso et al., 2007), соей ( Glycine max ; Nyoki and Ndakidemi, 2018) и горохом ( Pisum sativum ; Zhao et al. , 2020).

Корневые экссудаты играют важную роль на ранних стадиях колонизации растений, обеспечивая метаболиты, которые действуют как питательные вещества, хемоаттрактанты или противомикробные препараты для почвенных микробов (Lopez-Guerrero et al., 2013). Транскриптомный анализ ризобактерий, подвергшихся воздействию корневых экссудатов в течение короткого времени, позволил обнаружить ранние адаптивные реакции, которые в длительных экспериментах были бы замаскированы из-за микробного метаболизма или реабсорбции корневых метаболитов (Phillips et al., 2004; Сидоре и др., 2012; Се и др., 2015; Йи и др., 2018). Фактически, бактериальные гены, участвующие в метаболизме некоторых углеводов и аминокислот, подавляются в экссудатах корней кукурузы через 48 часов (Zhang et al., 2015).

Мы задались вопросом, есть ли преимущество у Rhizobium в ассоциированной культуре, и мы предположили, что в этом состоянии будет более богатый состав экссудатов, доступных для ризобий. Анализ секвенирования РНК из R. Phaseoli Ch34-10, стимулированного экссудатом бобов и кукурузы, выращенных в монокультуре или ассоциированных с milpa, может помочь решить эту проблему.Предыдущие транскриптомные исследования анализировали Ch34-10 в корнях кукурузы через несколько дней или в присутствии других бактерий (Gómez-Godínez et al., 2019). Мы выполнили здесь короткое воздействие экссудатов (2 часа), которое имеет то преимущество, что питательные вещества не будут истощены, как в долгосрочных анализах, и может быть обнаружена быстрая реакция на различные экссудаты растений.

Материалы и методы

Бактериальный штамм и приготовление инокулята

Штамм Ch34-10 Rhizobium Phaseoli был выделен из стеблей кукурузы системы milpa в Чолула, Пуэбла, Мексика.У кукурузы он колонизирует ризосферу и корни в качестве эндофита (Rosenblueth and Martínez-Romero, 2004) и обладает активностью, стимулирующей рост растений (Matus-Acuña et al., 2018). В симбиозе с фасолью Ch34-10 образует азотфиксирующие клубеньки. Ch34-10 культивировали в бульоне PY (5 г пептона, 3 г дрожжевого экстракта и 0,6 г CaCl 2 на литр) в течение 24 ч (экспоненциальная фаза) при 30°C при постоянном встряхивании. Культуры центрифугировали в течение 5 мин при 4025 × г и клеточные осадки промывали один раз 10 мМ MgSO 4 для использования в экспериментах с растениями.

Растения и экспериментальный дизайн

Семена фасоли обыкновенной (сорт Negro Jamapa) и кукурузы (староместный сорт «Negro criollo» из Идальго, Мексика) дезинфицировали поверхностью 70% этанола (1 мин), 1,2% гипохлоритом натрия (20 мин), пятикратно промывали дистиллированной водой. и 2% тиосульфата натрия (2 минуты и два раза промыть дистиллированной водой), как описано в Rosenblueth and Martínez-Romero (2004). Продезинфицированные семена проращивали на чашках с агаром и водой, а затем помещали на подставки из нержавеющей стали в стеклянные пробирки (25 × 200 мм), содержащие 50 мл раствора Фареуса, не содержащего N [0.132 г CaCl 2 , 0,12 г MGSO 4 ⋅7H 2 O, 0,1 г KH 2 , 0,075 г Na 2 HPO 4 ⋅2H 2 o, 0,005 г FE-цитрат, и 0,07 мг каждый из MNCL 2 ⋅4H 2 O, CUSO 4 ⋅5H 2 O, ZnCl 2 , H 3 BO 3 , а также NA 2 MoO 4 ⋅2H 2 O на литр милли-Q (сверхчистая вода типа 1)]. В каждой пробирке содержалось по два проростка: фасоль-фасоль, кукуруза-кукуруза и фасоль-кукуруза (система мильпа), которые содержались в течение 5 сут при 28°С с фотопериодом свет/темнота 16/8 ч в аксенических условиях.Нижняя часть гидропонной системы была покрыта крафт-бумагой, которая позволяет корням расти в темноте, а надземная часть — при наличии света (рис. 1), как это рекомендовано Silva-Navas et al. (2015). Инокулировали корни растений с 30 мл экссудата в конечной концентрации 10 8 клеток Ch34-10 мл –1 . Через 2 часа взаимодействия корень-бактерия во все пробирки перед выделением РНК добавляли 10% ( против / против ) реагента поздней РНК (Ambion). Каждая экспериментальная повторность включала корневой экссудат из трех пробирок.Было рассмотрено три повторения для всех обработок и для контролей без растений (раствор Фареуса без азота). Кроме того, по 1 мл из каждого корневого экссудата высевали в среду LB и PY и инкубировали в течение 3 дней для выявления микробной контаминации.

Рисунок 1. Гидропонная система для получения корневого экссудата. (A) Кукуруза и фасоль, выращиваемые в монокультуре и milpa. (B) Корни фасоли и кукурузы в тесте milpa.

Экстракция РНК и высокопроизводительное секвенирование

Бактерии из корневого экссудата концентрировали центрифугированием в течение 5 мин при 4025 × г при 4°С и немедленно замораживали осадки в жидком азоте.Суммарную РНК экстрагировали с использованием RNeasy Mini Kits (Qiagen) с протеиназой K (Qiagen), лизоцимом (Sigma-Aldrich) и ДНКазой I (Sigma-Aldrich). РНК количественно определяли с использованием спектрофотометра Nanodrop 2000 (Thermo Scientific), а число целостности РНК (RIN) образцов определяли с использованием системы электрофореза TapeStation 2200 (Agilent Technologies). Нашим критерием выбора подходящих образцов для секвенирования РНК было соотношение рРНК> 0,8 и RIN> 8. Рибосомные РНК удаляли с использованием протокола Ribo-Zero Bacteria (Illumina), а библиотеки кДНК готовили с использованием нецепочечного протокола TruSeq (Illumina).Высокопроизводительное секвенирование проводили на платформе Illumina HiSeq 4000 (100 нуклеотидных парных чтений) компании Macrogen Inc. (Сеул, Южная Корея).

Биоинформационный анализ

Качество сырых прочтений проводилось с помощью FASTQC v0.11.8 (Andrews, 2010), а некачественные последовательности и адаптеры Illumina удалялись с помощью Trimmomatic v0.39 (Bolger et al., 2014) с параметрами LEADING:3 TRAILING: 3 РАЗДВИЖНОЕ ОКНО:4:15 МИНДЛЕН:36. Bowtie2 v2.3.5 (Langmead and Salzberg, 2012) использовался для сопоставления чтений с R.геном Phaseoli Ch34-10 (GCF_000268285.2_RPHCh3410v2) с параметрами – очень чувствительный -q -p 20 -x -2 -S. Чтения с картированием парных концов, связанные с каждым геном, были количественно оценены с использованием featureCounts v1.6.4 (Liao et al., 2014). Пакет Bioconductor edgeR v3.6.0 использовался для дифференциального анализа экспрессии данных транскриптома (Robinson et al., 2010). Значения количества на миллион (CPM) были нормализованы с использованием метода усеченного среднего значения M (TMM) для оценки уровней экспрессии генов.Ген считался дифференциально активированным, если он имел кратность Log2 > 1 при пороге частоты ложных открытий (FDR) 0,95 со скорректированными значениями p ≤ 0,05 (Bustamante-Brito et al., 2019). С помощью веб-инструмента http://bioinformatics.psb.ugent.be/webtools/Venn/ были построены диаграммы Венна, чтобы показать исключительные и общие гены между обработками. Активированные гены были классифицированы по категориям COG (кластеры ортологичных групп) с помощью онлайн-версии eggNOG-mapper v2 (Huerta-Cepas et al., 2019).

Поколение мутантов Ch34-10

Два штамма, производных Ch34-10 (CCG-9A11 и CCG-VP1) с репортерными генами, были созданы в этом исследовании для проверки транскрипции ризобиальных генов, которые экспрессировались в присутствии корневых экссудатов.

Для CCG-9A11 мутагенез транспозона проводили с помощью pCAM140 (Tn5- gusA ; Wilson et al., 1995). Были отобраны мутанты, которые были индуцированы экссудатом кукурузы с использованием X-gluc и 4-MUG (протоколы см. ниже).Было подтверждено, что имеется только одна вставка Tn5 с помощью Саузерн-гибридизации с использованием фрагмента Tn5 в качестве зонда. Для локализации места вставки был получен и секвенирован клон. Инсерция была в гене RPHASCh3410_PD02690, кодирующем полигалактуроназу Gh38 (поли-альфа-1,4-галактуронид-гликаногидролазу).

Для мутанта CCG-VP1 проводили сайт-направленный мутагенез гена putA . Для этого фрагмент гена putA из Ch34-10 амплифицировали методом ПЦР с праймерами put767F (5’TTC AGTCGACGCGGCATCTATGACGGTCCTG3′) и put1527R (5’TTCAGGATCCATCAGCGCCTCGACCGAAACA3′) и клонировали в вектор pCR4-TOPO, следуя инструкциям производитель (Invitrogen).После проверки с помощью гель-электрофореза того, что клоны имеют правильный размер, их секвенировали для подтверждения того, что они содержат фрагмент из putA. Один из них был выбран для переноса фрагмента на суицидный вектор pJQ200mp18 (Quandt and Hynes, 1993). Кассета lacZ (pKOK6; Kokotek and Wolfgang, 1989) была вставлена ​​в участок Bgl II putA . Эта конструкция была сопряжена с Ч34-10 в тройственном скрещивании. Для отбора двойных рекомбинантов трансконъюганты высевали в 12% сахарозу.Профиль плазмиды визуализировали по методике Eckhardt (1978), модифицированной Hynes and McGregor (1990). Все клоны были получены в компетентных клетках штамма DH5-α Escherichia coli и отобраны соответствующими антибиотиками.

Анализы β-глюкуронидазы

Растения кукурузы и фасоли выращивали вместе или в монокультуре (как указано выше), а корневые экссудаты центрифугировали в течение 15 минут при 4025 × г для удаления растительных остатков. В 1 мл корневого экссудата инокулировали 10 8 клеток мл –1 производного Ch34-10 штамма CCG-9A11, имеющего в качестве репортера ген β-глюкуронидазы ( gusA ), и инкубировали при 30°С. С в течение 24 часов.Согласно Jefferson (1987) с модификациями Xi et al. (1999), активность β-глюкуронидазы, индуцированную корневым экссудатом, измеряли с помощью флуорометрического анализа с 4-MUG (гидрат метилумбеллиферил-β- D -глюкуронида; Sigma-Aldrich) в многорежимном ридере для микропланшетов Synergy h2 (BioTek). приборы) при длине волны излучения/возбуждения 365/460 нм. Используя эталонную кривую метилумбеллиферона (МУ), активность фермента выражали в нмМЕ/мин/10 6 клеток.

Для определения активности β-глюкуронидазы в корнях проростки кукурузы и фасоли, инокулированные CCG-9A11 или Ch34-10, культивировали в течение 15 дней в колбах с полутвердым раствором Fahraeus, не содержащим азота (Martínez et al., 1987). Целые корни дважды промывали водой MQ и помещали в пробирки объемом 50 мл с раствором X-gluc (5-бром-6-хлор-3-индолил β- D -глюкуронидциклогексиламмониевая соль; Gold biotechnology) на 48 ч при 28 °С на роторном шейкере (Шамсельдин, 2007). Синий сигнал внутри корней и клубеньков указывает на индукцию гена, в отличие от бесцветных корней, инокулированных Ch34-10, который не несет репортерный ген gusA (дополнительная фигура 1). Биологическую фиксацию азота клубеньками фасоли в монокультуре и в тысячелистнике измеряли с помощью анализа восстановления ацетилена с использованием газовой хроматографии и выражали в нмоль C 2 H 4 /ч/растение (Martínez et al., 1985).

Анализы β-галактозидазы

Для анализа β-галактозидазы CCG-VP1 выращивали в минимальной среде (MM), содержащей (на литр) K 2 HPO 4 3,8 г, KH 2 PO 4 3 г, сахарозу 1 г, NH 4 CL 1 г, MGSO 4 ⋅7H 2 o 0,1 г, CaCl 2 0,1 г, H 3 BO 3 2,86 мг, цитрат железа 5 мг, MNSO 4 ⋅4h 2 O 2,03 мг, ZnSO 4 ⋅7H 2 O 0.22 мг, CuSO 4 ⋅5H 2 O 0,08 мг и Na 2 MoO 4 ⋅H 2 O 0,08 мг при 30°C в течение 48 ч при непрерывном встряхивании (Montesal-Grajales. , 2019). Один миллилитр бактериальной культуры смешивали с 1 мл экссудатов кукурузы, фасоли или тысячелистника и инкубировали в течение 2 часов. Позже активность β-галактозидазы была измерена согласно Li et al. (2012) с использованием ONPG (о-нитрофенил-β- D -галактопиранозид; Sigma-Aldrich) в единицах Миллера (Mu). В качестве положительного контроля использовали ММ с пролином (20 мМ).

Анализ активности карбоангидразы

Ch34-10 инкубировали в 10 мл экссудатов кукурузы, фасоли и тысячелистника при 30°C, а клетки собирали через 2 и 24 часа путем центрифугирования при 9500 × г в течение 10 мин. Осадок клеток ресуспендировали в 50 мМ Tris-HCl pH 7,5 и разрушали ультразвуком (три цикла: 15 с плюс 60 с покоя) в анаэробных условиях. Затем гомогенат клеток центрифугировали при 6080 × g при 4°C в течение 3 мин, а супернатант (белковый экстракт) хранили на льду и сразу использовали для определения активности карбоангидразы (Santiago-Martínez et al., 2016). От одного до двух миллиграммов белкового экстракта с 1 мл буфера для анаэробной реакции (45 мМ Na-бикарбоната, pH 6,8 плюс 0,02 мМ ZnCl 2 ) инкубировали в запечатанных 2 мл флаконах с резиновой пробкой при 25°C. Буфер предварительно барботировали азотом в течение 30 минут, а воздух в головном пространстве каждой бутылки заменяли азотом для поддержания анаэробных условий. Для обнаружения образования CO 2 отбирали 5 мкл свободного пространства и вводили в разное время (0, 30, 60 и 120 с) в газовый хроматограф GC-2010-Shimadzu, оснащенный капиллярной колонкой HP-PLOT/ U длиной 30 м, 0.32 мм внутр. диам. пленка 10 мкм (Agilent, США) и детектор по теплопроводности. В качестве положительного контроля использовали коммерческую α-карбоангидразу из бычьих эритроцитов (Sigma-Aldrich) (модификация Veitch and Blankenship, 1963; Lira-Silva et al., 2012). Значения CO 2 , образованные в реакционном буфере для анализа без фермента и с кипяченым ферментом, вычитали из значений CO 2 , образованных образцами Ch34-10. Активность карбоангидразы выражали в нмоль СО 2 продукции/мин/мг белка.

Статистический анализ

Тест Стьюдента t использовали для сравнения сырого веса и нитрогеназной активности клубеньков фасоли из монокультуры и milpa. Для анализа множественных сравнений были выполнены однофакторный дисперсионный анализ и тест Тьюки на достоверно значимые различия. Пакет agricolae v1.3.5 в R studio использовался для статистического анализа, принимая во внимание, что значение p ≤ 0,05 статистически отличается (de Mendiburu and de Mendiburu, 2019).

Результаты

Для выявления быстрых ризобиальных реакций при 2-часовом воздействии экссудата на экссудаты корней фасоли и кукурузы из монокультуры или системы milpa (рис. 1) был проведен полный анализ транскриптома R.Phaseoli Ch34-10 проводили в четырех условиях: с экссудатами корней фасоли, экссудатами корней кукурузы, экссудатами корней milpa и раствором Фареуса, не содержащим азота. Поскольку бактериальные популяции, населяющие ризоплану, имеют различный метаболизм в зависимости от области корня, которую они колонизируют (Kragelund et al., 1997), транскриптомы бактерий, растущих в экссудатах растений, обладают тем преимуществом, что они более гомогенны и воспроизводимы. В нашем исследовании в среднем 75 миллионов парных и сопоставленных прочтений было получено из каждой тройки из четырех обработок.Более 98% прочтений RNA-seq было отнесено к геному Ch34-10. Анализ многомерной шкалы (MDS) на рисунке 2A показывает, что реплики сгруппированы близко друг к другу в четыре группы, которые соответствуют методам лечения. Транскриптомные данные в растворе Фареуса сильно отличались от данных, полученных в растительных экссудатах; в свою очередь, транскриптомные профили экссудатов фасоли и экссудатов milpa близки друг к другу, но далеки от профилей экссудатов корней кукурузы.

Рис. 2. Анализ дифференциальной экспрессии транскриптомных данных R. Phaseoli Ch34-10. (A) Многомерный анализ (MDS) профилей транскриптома RNA-seq Ch34-10 в корневых экссудатах и ​​растворе Фареуса. Количество на миллион (CPM) было нормализовано с использованием метода усеченного среднего M-значения (TMM). (B) Дифференциальная экспрессия генов Ch34-10 в корневых экссудатах по сравнению с раствором Фареуса. Ген считался дифференциально экспрессированным при пороге частоты ложных открытий (FDR), равном 0.95, скорректированные значения p ≤ 0,05 и кратное изменение Log2 > 1 (повышенная регуляция) или <1 (пониженная регуляция) с использованием пакета edgeR v3.6.0. (C) Диаграмма Венна между активированными генами Ch34-10, индуцированными экссудатами бобов и кукурузы. (D) Диаграмма Венна между активированными генами Ch34-10, экспрессируемыми в монокультурах кукурузы и бобов, и milpa. Диаграммы Венна были созданы с использованием веб-инструмента, доступного по адресу http://bioinformatics.psb.ugent.be/webtools/Venn/, чтобы показать исключительные и общие гены между обработками.

Дифференциально сверхэкспрессированные гены были обнаружены в R. Phaseoli , инкубированном в течение 2 часов в корневых экссудатах (см. Рисунок 2B) фасоли обыкновенной (дополнительная таблица 1), кукурузы (дополнительная таблица 2) и тысячелистника (дополнительная таблица 3). транскриптов R. Phaseoli раствора Fahraeus использовали для различения генов, которые экспрессировались в результате гидропонных компонентов, а не в присутствии корней растений; дифференциально экспрессируемые гены при этом условии здесь рассматриваться не будут.Была предложена метаболическая модель в ответ на экссудаты, чтобы показать основные метаболические пути и клеточные функции Ch34-10 в ризосфере кукурузы, фасоли и системы milpa (рис. 3). Гены Ch34-10, участвующие в этих адаптационных процессах, подробно описаны ниже для каждой обработки экссудатом.

Ризобиальные гены экспрессируются только в экссудатах корня фасоли

В экссудатах P. vulgaris 176 генов Ch34-10 были высоко экспрессированы по сравнению с экссудатами кукурузы (рис. 2C).Они были распределены в хромосоме (66%), хромиде pRpCh34-10d (17%), симбиотической плазмиде (pSym) pRpCh34-10c (7%), плазмиде pRpCh34-10b (5%) и плазмиде pRpCh34-10a (5%). ). Среди них мы обнаружили генов nodA , nodB и генов nodC , необходимых для синтеза Nod фактора. NODS , NODU , NOLE , NOLO , NOLO , NOEI и NOLL Гены, кодирующие ферменты, которые изменяют факторы Nov , кодированные ферменты, которые изменяют коэффициенты Nows с помощью метилирования, карбамоилирования, фукозилирования или ацетилирования, а также гены nodI , nodJ и nodT участвуют в секреции Nod-факторов (фиг. 4А).В соответствии с этими выводами три регуляторных гена nodD были обнаружены в Ch34-10, причем nodD1 экспрессировался наиболее высоко.

Рисунок 4. Экспрессия ризобиальных генов, индуцируемая корневым экссудатом. Тепловые карты, показывающие уровни экспрессии генов, участвующих в биосинтезе и транспорте (A) фактора Nod, (B) деградации ароматических соединений, (C) ферментативном гидролизе растительных углеводных полимеров, (D) поглощении железа, (E) транспорт питательных веществ, (F) система секреции типа 3 (T3SS) и (G) жгутиковые системы и подвижность.Цветовые шкалы показывают Log2CPM, полученные методом нормализации усеченного среднего M-значения с использованием пакета edgeR v3.6.0. Показаны профили транскрипции в трех экземплярах для каждого лечения.

Ген pobA кодирует п-гидроксибензоатгидролазу, участвующую в образовании протокатехуата из гидроксибензоата, который является одним из основных фенолов, связывающихся со стенками растительной клетки (Sircar and Mitra, 2008). Гены из регулона pca и положительного регулятора pcaR катаболизма протокатехуатов индуцировались бобами (рис. 4В).PcaR также играет роль в хемотаксисе по отношению к ароматическим соединениям (Romero-Steiner et al., 1994). Дифференциально экспрессируется 4-оксалокротонаттауромераза, окисляющая бензол, толуол и ксилол. Мы также обнаружили увеличение количества генов транспортеров ABC, которые, как сообщалось, индуцировались экссудатом фасоли у Rhizobium tropici (Rosenblueth et al., 1998) и осмотическим стрессом, как и транспортная система для глицина, бетаина и пролина, аналогичная ProVWX из . E. coli (Лухт и Бремер, 1994).

Ризобиальные гены экспрессируются только в экссудатах корней кукурузы

В экссудатах кукурузы активировались триста семь генов по сравнению с экссудатами фасоли (рис. 2C), 209 сверхэкспрессированных генов были обнаружены в хромосоме, 48 генов в хромиде, 23 гена в pRpCh34-10b, 21 ген в pRpCh34-10a и всего 6 генов в pSym pRpCh34-10c. Гены, участвующие в транспорте арабинозы, рамнозы, ксилозы, мальтозы, маннита и биотина (рис. 4E), а также в расщеплении слизи, такие как гены α-фукозидазы, α-галактозидазы и β-глюкозидазы (рис. 4C), были обнаружены сверхэкспрессированными.Ch34-10 с экссудатами кукурузы также показал активацию транспортера DctPQM для C4-дикарбоксилатов и его двухкомпонентной регуляторной системы DctB/DctD.

Также наблюдалась повышенная экспрессия генов деградации эвгенола ( calA и calB ) и феруловой кислоты ( fcs и ech ; рис. 4B), а также синтеза сидерофора вицибактина и его транспорта (рис. 4Д). Три копии гена dapA , кодирующего дигидродипиколинатсинтазу пути биосинтеза лизина, были обнаружены как активированные; то же самое относится к генам, кодирующим хоризмат- и антранилатсинтазы, которые могут способствовать выработке фенилаланина, тирозина и триптофана.Кроме того, экссудаты кукурузы также индуцировали сверхэкспрессию генов транскрипционного регулятора семейства Lrp/AsnC, обычно активируемого экзогенными аминокислотами, и регуляторного белка поглощения железа (Fur), который контролирует гомеостаз железа и биосинтез сидерофоров (Hassan and Troxell, 2013).

Ризобиальные гены, индуцированные монокультурами фасоли или кукурузы

Когда транскрипты Ch34-10 из экссудатов фасоли сравнивали с транскриптами из экссудатов кукурузы, в обоих условиях было обнаружено 616 генов с повышенной экспрессией (рис. 2C и дополнительная таблица 4).Большинство этих генов были расположены на хромосоме (72%) и хромиде (13%), а некоторые из них в плазмидах pRpCh34-10b (7%), pRpCh34-10a (4%) и pSym pRpCh34-10c ( 4%).

Среди генов с наибольшей экспрессией мы идентифицировали те, которые кодируют ABC-переносчики сахаров, аминокислот и полиаминов, а также нитратов, сульфатов и фосфатов, а также генов tctABC и occQMPT , необходимых для импорта трикарбоксилатов и октопина. , соответственно (рис. 4E).Еще одним открытием был высокий уровень экспрессии оперона dppBCDF , ответственного за импорт ди/трипептидов. Было обнаружено, что гены переносчиков олигопептидов экспрессируются после того, как Ch34-10 сохраняется в течение нескольких дней как в корнях фасоли, так и в корнях кукурузы (López-Guerrero et al., 2012). Гены ключевых ферментов, участвующих в катаболизме лизина, гистидина, глутамата и треонина, также были высоко экспрессированы, например, гены hutH , hutU , hutI , hutF и hut8G, которые полностью включают два основных пути утилизации гистидина.

Индукция генов наблюдалась для нескольких эффлюксных насосов, таких как RmrAB, AcrAB-TolC, EmrAB-TolC и MATE (экструзия нескольких лекарств и токсичных соединений), а также для системы секреции типа 3 (T3SS), которая напоминает аппарат вирулентности Ysc-Yop . Yersinia enterocolitica (рис. 4F). Гены сборки жгутикового мотора, крючковидного и базального комплекса, а также биосинтеза флагеллина экспрессируются во всех транскриптомах. Однако большее количество жгутиковых транскриптов было восстановлено с помощью P.vulgaris , чем в экссудатах кукурузы (рис. 4G).

В обоих корневых экссудатах многие гены, кодирующие рибосомные белки, активировались, включая S1, S2, от S3 до S15 и от S18 до S21, связанных с субъединицей 30S, и от L1 до L6, L9, L10, L11, L13, L14, от L18 до L25, L27, L28 и от L31 до L36, связанные с субъединицей 50S, а также гены, кодирующие аминоацил-тРНК-лигазы для метионина, цистеина, аспартата, тирозина, фенилаланина, гистидина и изолейцина.Мы также обнаружили гены регуляторов транскрипции с высокой экспрессией, такие как принадлежащие к семействам FadR, DeoR/GlpR, TetR/AcrR и ROK. Эти транскрипционные факторы управляют физиологическими реакциями, связанными с метаболизмом сахара, чувством кворума, множественной лекарственной устойчивостью и вытеснением токсичных соединений, среди многих других.

Транскриптомные профили

R. Phaseoli в Милпе

Семьсот восемьдесят пять генов Ch34-10 были обнаружены в высокой экспрессии в milpa по сравнению с данными транскриптомии в растворе Фареуса (рис. 2B и дополнительная таблица 3).Среди них 566 генов с повышенной экспрессией были обнаружены в хромосоме, 104 в хромиде, 43 в pRpCh34-10b и по 36 как в pRpCh34-10a, так и в pSym pRpCh34-10c.

Другим интересным сравнением были транскрипты Ch34-10 в milpa с транскриптами из экссудатов фасоли и экссудатов кукурузы, где мы обнаружили 42 и 38 дифференциально экспрессируемых генов соответственно (дополнительные таблицы 5, 6). Транскриптомные профили, наблюдаемые у milpa, напоминают профили экссудатов фасоли, частично из-за генов нодуляции (синтез, модификация и транспорт Nod-факторов), которые проявляют сходные уровни экспрессии в обоих состояниях (рис. 4А).Фасоль в milpa формировала азотфиксирующие клубеньки после 15 дней инокуляции Ch34-10 в полутвердой среде (рис. 5А), и мы не обнаружили статистически значимых различий по сравнению с сырой массой и азотфиксацией клубеньков фасоли в монокультуре (рис. 5В). ,С). Неожиданно экссудаты кукурузы значительно индуцировали экспрессию гена nodA (кратность изменения Log2 = 1,4), но не на уровнях, которые наблюдались с обоими растениями вместе в экссудатах milpa (кратность Log2 = 4,5) и экссудатах фасоли (кратность Log2 изменения = 4.7; Дополнительная таблица 4). Гены деградации протокатехата, феруловой кислоты (рис. 4В) и растительных углеводных полимеров (рис. 4С), экспрессированные в milpa, сходным образом экспрессировались в экссудатах кукурузы.

Рисунок 5. Клубеньки у фасоли монокультуры и тысячелистника. (А) Азотфиксирующие клубеньки растений фасоли через 15 дней после инокуляции R. Phaseoli Ch34-10. Узелки показаны красными стрелками. Сравнение сырой массы (В) и нитрогеназной активности (В) клубеньков фасоли из монокультуры и милпа.

С другой стороны, 591 экспрессированный ген milpa был обнаружен в транскриптомах монокультур (рис. 2D и дополнительная таблица 4). Например, были обнаружены гены, кодирующие ABC-переносчики сахаров, аминокислот, октопинов и железа, а также гены, кодирующие ферменты продукции орнитина, путресцина и гомоспермидина. Точно так же наблюдалась экспрессия генов катаболизма аминокислот, таких как гистидин, тирозин и фенилаланин. Кроме того, многие из активированных генов во всех экссудатах были связаны с функциональными категориями COG, такими как транспорт и метаболизм углеводов, аминокислот и неорганических ионов, транскрипция, трансляция и биогенез рибосом (дополнительная фигура 2).Повышенный уровень экспрессии генов Ch34-10, кодирующих белки экструзии токсичных метаболитов растений (системы RmrAB, EmrAB, AcrAB), наблюдался в корневых экссудатах как монокультур, так и milpa, а также генов, кодирующих транслокон SecYEG, SecDF белок-экспорт мембранного белка и компонентов из T3SS.

Ризобиальные гены, кодирующие несколько переносчиков пролина, были высоко экспрессированы во всех корневых экссудатах. Мы создали штамм CCG-VP1, который является мутантом Ch34-10, пораженным геном putA , кодирующим бифункциональную пролиндегидрогеназу/пирролин-5-карбоксилатдегидрогеназу, участвующую в катаболизме пролина (Liu et al., 2017), таким образом, CCG-VP1 не может расти в ММ с L-пролином в качестве единственного источника углерода и азота (дополнительная фигура 3). Экспрессию putA оценивали, используя β-галактозидазную активность CCG-VP1; Ген putA индуцировали в присутствии экссудатов бобов, кукурузы и тысячелистника, а также при добавлении пролина к ММ в качестве положительного контроля (фиг. 6).

Рисунок 6. Активность β-галактозидазы CCG-VP1 в ответ на корневой экссудат в течение 2 часов.CCG-VP1 представляет собой Ch34-10, содержащий репортерный ген lacZ , смежный с геном putA . Активность β-галактозидазы определяли колориметрическим анализом с использованием ONPG. Различные строчные буквы между вариантами лечения показывают статистически значимые различия ( p -значение ≤ 0,05) в соответствии с дисперсионным анализом, за которым следует тест Тьюки на достоверно значимые различия. Было выполнено три повторения для каждой обработки.

Среди генов, экспрессия которых была сверхэкспрессирована в milpa по сравнению с монокультурами, мы обнаружили гены, кодирующие глюкозидгидролазы для деградации пектина.Экспрессию генов гликозидгидролазы дополнительно исследовали в штамме CCG-9A11 с транскрипционным слиянием gusA в гене Ch34-10, кодирующем полигалактуроназу Gh38 (поли-альфа-1,4-галактуронид-гликаногидролазу). В течение первых 2 часов воздействия корневых экссудатов экспрессия гена полигалактуроназы (обозначенная как активность β-глюкуронидазы) была выше в экспериментах с экссудатами кукурузы и тысячелистника, чем с фасолью (рис. 7А). Однако через 24 часа активность β-глюкуронидазы была выше в экссудате milpa (199.1 ± 16 нмМЕ) по сравнению с экссудатом фасоли (168,2 ± 3 нмМЕ) и кукурузы (170,1 ± 9 нмМЕ). Мы инокулировали CCG-9A11 на растения, и активность β-глюкуронидазы была обнаружена в клубеньках фасоли (рис. 7B, D), а также в боковых корнях кукурузы (рис. 7C, D), независимо от того, были ли они выращены отдельно или в milpa.

Рисунок 7. Активность β-глюкуронидазы CCG-9A11 в ответ на растения. CCG-9A11 представляет собой Ch34-10 со слитым геном gusA выше гена полигалактуроназы. (A) Активность β-глюкуронидазы, индуцированную корневым экссудатом, измеряли с помощью флуорометрического анализа с 4-MUG. Было выполнено три повторения для каждой обработки. Различные буквы между вариантами лечения показывают статистически значимые различия (90 357 p 90 358 -значение ≤ 0,05) в соответствии с ANOVA с последующим тестом Тьюки на достоверно значимые различия. Строчными и прописными буквами показаны различия через 2 и 24 ч воздействия корневого экссудата соответственно. Активность β-глюкуронидазы в пределах (B) клубеньков фасоли и (C) корней кукурузы в монокультуре и (D) в системе milpa.Синий сигнал внутри корней указывает на индукцию гена полигалактуроназы.

Ген

RPHASCh3410_Ch22295, кодирующий хромосомную β-карбоангидразу, экспрессировался в условиях монокультуры и milpa, поэтому была оценена эта ферментативная активность в Ch34-10 (таблица 1 и дополнительная фигура 4). Результаты показали, что в экссудатах милпа активность карбоангидразы была выше через 2 ч (794 ± 56 нмоль CO 2 продукции/мин/мг) по сравнению с кукурузой (640 ± 42 нмоль CO 2 продукции/мин/мг). белок) и экссудаты фасоли (673 ± 45 нмоль CO 2 продукции/мин/мг белка), и эта тенденция сохранялась через 24 часа.

Таблица 1. Активность карбоангидразы Ч34-10 после обработки корневым экссудатом в течение 2 и 24 ч.

Обсуждение

Зерново-бобовые ассоциации обычно используются в сельском хозяйстве с кукурузой в качестве предпочтительного злака в сочетании с P. vulgaris , конскими бобами или соей. Когда зерновые сочетаются с бобовыми, лучше контролируются болезни и насекомые-вредители (Fininsa, 1996), а почва сохраняется лучше, чем при монокультуре. Кроме того, микробное разнообразие ризосферы смешанных культур больше, поскольку корневые экссудаты действуют как питательные вещества и хемоаттрактанты, позволяющие микроорганизмам колонизировать новых хозяев, что приводит к разделению микробиоты между растениями, включая эндофиты в виде ризобий (Гутьеррес-Самора и Мартинес). -Ромеро, 2001; Моммер и др., 2016). Ассоциация предков кукурузы, milpa, возникла в Мезоамерике, поскольку кукуруза и P. vulgaris являются местными для этой области. Мы разработали мини-мильпу в лаборатории в гидропонных условиях для оценки раннего воздействия экссудатов милпа на R. Phaseoli Ch34-10, который является выдающимся штаммом Rhizobium .

Состав экссудата не является универсальной характеристикой вида растения, он может различаться у особей одного вида, варьироваться в зависимости от возраста растения, факторов окружающей среды и питательных веществ, доступных растению (Carvalhais et al., 2011). Экссудация метаболитов кукурузой и фасолью со временем меняется; однако некоторые корневые метаболиты высвобождаются как на ранних, так и на поздних стадиях роста растений (da Silva Lima et al., 2014; Tawaraya et al., 2014). Каждое растение может содержать отдельные эндофиты, которые могут трансформировать или даже производить экссудированные молекулы. Два вида растений вместе могут оказывать новое избирательное давление на эндофиты. Таким образом, исход экссудатов может быть различным в ассоциированных корнях. В свою очередь, изменения профилей экссудации влияют на метаболизм микробиоты ризосферы (Chaparro et al., 2013; Vacheron и др., 2013). Ризобии в корнях используют сахара и аминокислоты из экссудата и могут конкурировать с патогенами, помимо выработки растительных гормонов, как и другие бактерии, стимулирующие рост растений (Rosenblueth and Martínez-Romero, 2006).

Кукуруза выделяет больше фотосинтеза, чем растения фасоли, что может быть связано с их большой фотосинтетической способностью С4 (Brown et al., 2005). Корни кукурузы в основном секретируют глюкозу, мелибиозу, мальтозу и фруктозу (Fan et al., 2012). Их экссудаты богаты аминокислотами, такими как аспарагиновая кислота, глутаминовая кислота, глутамин, серин и аланин, но содержат мало лизина (Carvalhais et al., 2011). Примерно 25 % органических соединений, поступающих в корневую систему кукурузы, выделяется с экссудатами (Haller, Stolp, 1985). Более общий ответ Ch34-10 на деградацию сахара, слизи и пектина может проявляться в экссудате кукурузы с высокой экспрессией генов фукозидазы, галактозидазы и полигалактуроназы. Подход репортерного гена подтвердил, что полигалактуроназа в высокой степени экспрессируется в экссудатах кукурузы из монокультуры или в ассоциации с фасолью (рис. 7А). Сахара, такие как галактоза, фукоза, манноза, арабиноза, ксилоза и глюкоза, вместе с уроновыми кислотами, такими как галактуроновая кислота и глюкуроновая кислота, являются основными компонентами слизи (Nazari et al., 2020). Гены переносчиков и ферментов метаболизма этих сахаров были экспрессированы в экссудатах кукурузы, поэтому Ch34-10, возможно, потребляет их в качестве источников углерода, как только они высвобождаются из растительных полимеров или непосредственно из экссудатов. Rhizobium leguminosarum продуцирует карбогидразы, связанные с его способностью расти в слизи как единственном источнике углерода (Knee et al., 2001).

Некоторые бактерии обычно используют сахара и аминокислоты из экссудатов растений в качестве основных питательных веществ, поэтому органические кислоты могут накапливаться в ризосфере (Koo et al., 2005). Яблочная кислота, фумаровая кислота, янтарная кислота и другие кислоты выделяются корнями кукурузы (Fan et al., 2012), вызывая закисление ризосферы, как показано на дополнительной диаграмме 5. Экссудаты кукурузы и милпа более кислые, чем экссудаты бобов с 7-дневного возраста. — старые растения (дополнительная фигура 6), как это было описано для смешанных культур кукурузы и фасоли, где ризосфера закислена в результате увеличения секреции карбоновых кислот и протонов (Li et al., 2007). Наши данные транскриптома показывают, что специализированные бактериальные механизмы для восприятия и транспорта дикарбоновых кислот активируются экссудатами кукурузы.C4-дикарбоксилаты преимущественно используются ризобиями, и их транспорт необходим для эффективного симбиоза (Iyer et al., 2016). Органические кислоты также могут диссоциировать Fe-минералы и улучшать усвоение железа растениями, предотвращая хлороз (Abadía et al., 2002). На корнях кукурузы в почве может существовать разнообразная микробная популяция с последующей конкуренцией за железо. Вицибактин представляет собой циклический тригидроксаматный сидерофор, первоначально описанный в R. leguminosarum , который является близким родственником R.Phaseoli (Wright et al., 2013). Здесь мы обнаружили, что ген вицибактинацетилазы был сильно экспрессирован в экссудатах кукурузы, что позволяет предположить, что вицибактин вырабатывается и что железо может быть лимитирующим в экссудатах кукурузы.

Ферментативную активность карбоангидразы

количественно определяли в клеточных экстрактах R. Phaseoli Ch34-10, подвергшихся воздействию экссудатов тысячелистника, кукурузы или бобов в течение 2 или 24 часов. Сходная активность была зарегистрирована в ризобиях из экссудатов кукурузы или бобов и более высокая активность в клетках ризобий, которые были экссудатами milpa (таблица 1).Мы показали, что ферментативная активность отражает транскриптомные результаты. Карбоангидраза продуцирует карбонат, который ризобии могут выделять в корни, уменьшая кислотность экссудата и косвенно облегчая котранспорт монокарбоксилатов с протоном; однако это может быть не так, потому что инокуляция ризобий на экссудат не изменяет pH экссудата (не показано). Таким образом, карбонат может быть углеродным субстратом для ризобий, что позволяет им извлекать выгоду из CO 2 , полученного из корней, и это может обеспечить экологическое преимущество для ризобий.Роль бактериальной карбоангидразы во взаимодействиях растений и микроорганизмов до сих пор неизвестна; однако эндофиты пшеницы, продуцирующие этот фермент, усиливают фотосинтез и рост растений (Aslam et al., 2018).

Мы делаем вывод, что феруловая кислота может быть важным компонентом питания ризобий в экссудатах кукурузы. Феруловая кислота представляет собой обильную фенольную кислоту, прикрепленную к стенкам растений, и ее содержание в кукурузе как минимум в десять раз больше, чем в других злаках (Bento-Silva et al., 2018). Феруловая кислота выделяется корнями кукурузы (Zhang et al., 2020). В фасоли кумаровая кислота и 4-гидроксибензоат могут предпочтительно использоваться Ch34-10 в соответствии с уровнем экспрессии гена pobA и оперона pca . Кумаровая кислота и 4-гидроксибензоат в изобилии содержатся в экссудатах фасоли на ранних стадиях развития растений (Tawaraya et al., 2014). Мы также обнаружили дифференциал R . Phaseoli экспрессия генов хемотаксиса ароматических соединений в фасоли. Способность Ch34-10 разлагать ароматические соединения растений может обеспечить лучшую приспособленность в ризосфере обеих культур за счет предоставления источников углерода, а также механизмов детоксикации.Другие штаммы P. vulgaris с клубеньковыми ризобиями, такие как R. tropici CIAT899, обладают способностью метаболизировать полициклические ароматические углеводороды (González-Paredes et al., 2013).

Некоторые аминокислоты, такие как аспарагин, фенилаланин, триптофан, треонин и валин, вырабатываются корнями кукурузы и фасоли, а также цитрат и фумарат органических кислот (Pellet et al., 1995; Carvalhais et al., 2011; Fan et al., 2012; Таварая и др., 2014). Мы обнаружили экспрессию генов Ch34-10, кодирующих транспортеры, такие как транспортеры цитрата, аминокислот и пептидов, в данных транскриптома фасоли и кукурузы.Транспортеры путресцина и спермидина также были сверхэкспрессированы в обоих растениях. Полиамины были обнаружены в экссудатах фасоли (Tawaraya et al., 2014), но их присутствие в экссудатах кукурузы изучено недостаточно. Пролин является широко распространенной аминокислотой в экссудатах кукурузы (Phillips et al., 2004), а также вырабатывается корнями фасоли на разных стадиях роста (Tawaraya et al., 2014). Ген putA использовался в качестве биосенсора для мониторинга экссудации пролина корнями гороха (Rubia et al., 2020), и его сверхэкспрессия в штаммах Sinorhizobium meliloti повышает их конкурентоспособность в отношении колонизации и образования клубеньков люцерны ( Medicago sativa ). Л.; ван Диллевейн и др., 2001). В этой работе экспрессия putA индуцировалась при воздействии экссудата в течение 2 часов, но статистически значимых различий между обработками растений не наблюдалось (рис. 6). Однако CCG-VP1 не влияет на колонизацию корней кукурузы (ризосферную и эндофитную), но менее конкурентоспособен при заселении клубеньков фасоли по сравнению с диким штаммом (дополнительная фигура 7). Гены регулятора транскрипции YjgM (OatM) активировались в экссудатах кукурузы, бобов и тысячелистника.У Salmonella YigM активирует цистеиновый регулон (VanDrisse and Escalante-Semerena, 2018), и было бы интересно дополнительно определить, продуцирует и выделяет ли Ch34-10 цистеин в корнях растений. Анализ экзометаболома показал, что Ch34-10 может выделять аминокислоты, такие как аспарагиновая кислота, аланин, тирозин и фенилаланин, при росте в ММ (Montes-Grajales et al., 2019).

В системе совмещения кукурузы и фасоли корни бобовых стимулируют экспрессию генов Bx, необходимых для биосинтеза фитоалексинов DIMBOA (2,4-дигидрокси-7-метокси-1,4-бензоксазин-3-он) и MBOA ( 6-метокси-2-бензоксазолинон) в кукурузе (Yan et al., 2014). Микробное разнообразие ризосферы кукурузы с дефицитом DIMBOA или MBOA отличается от такового дикого типа, поэтому метаболиты кукурузы также могут ограничивать рост почвенных микробов (Cotton et al., 2019; Cadot et al., 2021). Фитоалексины, продуцируемые системой milpa, не определены; однако мы обнаружили сверхэкспрессию генов Ch34-10 rmrA и rmrB , которые были описаны у Rhizobium etli как важные для устойчивости к фитоалексину, фазолину и флавоноидам бобов (Gonzalez-Pasayo and Martínez-Romero, 2000). ). R. Phaseoli Ch34-10 способен расти в присутствии фитоалексина MBOA из кукурузы (Rosenblueth and Martínez-Romero, 2004). Гены, кодирующие компоненты T3SS, индуцировали в Ch34-10 монокультурами и системой milpa. Эффекторы T3SS Rhizobium вводятся в клетки растения-хозяина и играют роль в симбиозе, возможно, ингибируя защитные реакции растений (Marie et al., 2001). Структурные компоненты ССТТ, которые кодируют компоненты шприца, достаточно консервативны, в то время как эффекторы могут быть более вариабельными, и их эффекты до конца не выяснены (Nelson and Sadowsky, 2015).

Подобно нашим результатам, высокие уровни экспрессии ризобиальных генов nod наблюдались в ответ на экссудаты P. vulgaris , которые содержат дайдзеин, нарингенин и генистеин, даже выше, чем уровни, индуцированные синтетическими флавоноидами (Bolaños-Vásquez и Вернер, 1997). Кукуруза может синтезировать несколько флавоноидов, и некоторые из них секретируются корнями (Li et al., 2016; Jin et al., 2017). Мы обнаружили, что ген Ch34-10 nodA активировался в экссудатах кукурузы по сравнению с раствором Фареуса, но не так сильно, как в экссудатах фасоли.A nodA lacZ транскрипционное слияние R. leguminosarum bv. Phaseoli RBL 1283 также индуцировался экссудатом зерен кукурузы (Hungria et al., 1997). Недавний протеомный анализ Vora et al. (2021) показали экспрессию белка NodU из Ensifer ( Sinorhizobium ) fredii NGR234 в ответ на экссудаты кукурузы, выращенной в монокультуре и в сочетании с Cajanus cajan . Механизм, с помощью которого кукуруза активирует экспрессию некоторых генов nod , до сих пор неизвестен, но было бы интересно выяснить, различается ли, как у бобовых, индукция ризобиальных генов кукурузой среди культурных сортов.Разнообразие грибов и микробные взаимодействия с кукурузой зависят от сорта (Matus-Acuña et al., 2021).

В условиях milpa наблюдался доминирующий эффект экссудатов фасоли, возможно, потому, что они содержат флавоноиды, которые специфичны для индукции экспрессии гена Rhizobium (Bolaños-Vásquez and Werner, 1997). Гены биосинтеза флавоноидов регулируются сложными механизмами у растений (Falcone-Ferreyra et al., 2012), и их концентрация в экссудатах может быть неодинаковой в монокультуре фасоли и у тысячелистника.Мы не определяли их количество; тем не менее, мы обнаружили сходные уровни экспрессии генов Ch34-10 nod в экссудатах монокультур фасоли и тысячелистника. Экстракты из почв, где кукуруза и бобы выращивались вместе, являются эффективными индукторами генов клубеньков у Rhizobium (Hungria et al., 1997).

Мы наблюдали аналогичные клубеньки у бобов, выращенных отдельно и вместе с кукурузой (рис. 5). Противоречивые результаты были получены в полевых условиях, где количество и биомасса клубеньков фасоли, выращенных между посевами кукурузы, как правило, выше, чем при выращивании монокультурных бобов (Cardoso et al., 2007; Латати и др., 2013). Концентрация азота в ризосфере бобово-кукурузной системы совмещения культур также выше; однако этот эффект варьируется в зависимости от физико-химических характеристик почвы и культивируемых местных сортов (Latati et al., 2013). В долгосрочной перспективе азот, поставляемый клубеньками фасоли, может быть полезен для кукурузы, которая нуждается в этом элементе в больших количествах для своего роста. Эта метаболическая комплементарность между ризобиями, фасолью и кукурузой может способствовать высокому урожаю зерна, наблюдаемому в полевых условиях (Cardoso et al., 2007; Чжан и др., 2014 г.; Агилар-Хименес и др., 2019).

Некоторые ризобиальные гены, экспрессируемые в независимых экссудатах кукурузы и фасоли, отличались от тех, которые экспрессировались в экссудатах кукурузы и фасоли, растущих вместе. Могут ли на производство растительного экссудата повлиять экссудаты соседнего растения? Экссудируемые молекулы гетерологичных или даже гомологичных корней могут регулировать экссудацию (Wang et al., 2021). Это интересная возможность, которую можно было бы изучить. Здесь мы предполагаем, что экссудаты кукурузы и бобов вместе могли обеспечить большее разнообразие питательных веществ для Rhizobium , чем анализы экссудации отдельных растений.Тем не менее, Ch34-10 может не нуждаться в экспрессии генов для использования питательных веществ, которые могут быть второстепенными компонентами в milpa, но в монокультурах активация этих генов дала бы преимущество ризобиям (рис. 8). В этом смысле мы можем объяснить, почему гены некоторых переносчиков сахаров и дипептидов не индуцируются в лабораторном экссудате milpa. Минорные компоненты, которые могли бы быть оставлены для последующих трофических событий, могут не проявляться через 2 ч. Rhizobia могут участвовать в разложении растительных полимеров, для разложения которых требуется больше стадий и которые гарантировали бы больший рост за счет последующего использования ресурсов, полученных в результате разложения пектина, слизи или фенольных кислот.На сельскохозяйственных полях может быть очень выгодно стимулировать рост бактерий в растущих растениях, используя способность ризобий метаболизировать питательные вещества, выделяемые корнями, в том числе те, которые получены из стенок растений или пограничных клеток.

Рисунок 8. Краткое описание функций ризобий, связанных с монокультурами и системой milpa. Внутри ризобиальных клеток показаны усиленные функции, индуцированные каждым корневым экссудатом, в то время как синяя рамка включает функции, общие для всех состояний.На диаграмме представлены результаты, полученные в результате анализа транскриптома, оценки транскрипционных слияний, а также ферментативного анализа и анализа клубеньков.

Заявление о доступности данных

Транскриптомные данные этого исследования в виде файлов BAM были депонированы в NCBI BioProject под регистрационным номером PRJNA578720 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA578720).

Вклад авторов

JLA-N и EM-R задумали и разработали эксперименты. JLA-N проводила эксперименты с растениями, ферментативные анализы, экстракцию РНК, а также биоинформатический и статистический анализы.MR генерировал бактериальные мутанты и оценивал их фенотипы в ответ на корневые экссудаты. MGS-M провела экстракцию белка и анализ активности карбоангидразы. JLA-N и EM-R проанализировали данные и написали рукопись. Все авторы рассмотрели статью и одобрили представленную версию.

Финансирование

JLA-N был доктором философии. студент Programa de Doctorado en Ciencias Bioquímicas в UNAM и получил стипендию от Consejo Nacional de Ciencia y Tecnologìa (CONACyT) (CVU 633925).Эта работа была поддержана грантами от PAPIIT-UNAM (IN210021) для EM-R.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Примечание издателя

Все претензии, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций или издателя, редакторов и рецензентов.Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

Благодарности

Мы благодарим Рафаэля Бустаменте-Брито и Виктора Мануэля Хигареда-Альвеар за советы по инструментам биоинформатики, Майкла Данна за корректуру рукописи, а также Алисию Вилчис Седильо и Веронику Перес Эскаланте за техническую помощь. Все биоинформационные анализы проводились на серверах CCG-UNAM.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2021.740818/full#supplementary-material

Сноски

    Каталожные номера

    Абадиа, Дж., Лопес-Миллан, А.Ф., Ромбола, А., и Абадиа, А. (2002). Органические кислоты и дефицит Fe: обзор. Почва для растений 241, 75–86. дои: 10.1023/A:1016093317898

    Полнотекстовая перекрестная ссылка | Академия Google

    Агилар-Хименес, К. Э., Гальдамес-Гадамес, Х., Мартинес-Агилар, Ф. Б., Гевара-Эрнандес, Ф., и Васкес-Солис, Х.(2019). Eficiencia del policultivo maíz-frijol-calabaza bajo manejo organico en la Frailesca, Чьяпас, Мексика. Revista Científica Агроэкосистемы. 7, 64–72.

    Академия Google

    Агирре-фон-Вобезер, Э., Роша-Эстрада, Дж., Шапиро, Л.Р., и де ла Торре, М. (2018). Обогащение Verrucomicrobia, Actinobacteria и Burkholderiales стимулирует отбор бактериального сообщества из почвы корнями кукурузы в традиционной агроэкосистеме milpa. PLoS One 13:e0208852.doi: 10.1371/journal.pone.0208852

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Альбино-Гардуньо, Р., Туррент-Фернандес, А., Кортес-Флорес, Дж. И., Ливера-Муньос, М., и Мендоса-Кастильо, М. К. (2015). Distribución де raíces у де radiación солнечной ан-эль-dosel де Maíz у frijol intercalados. Agrociencia 49, 513–531.

    Академия Google

    Альфонсо, К., Риверол, М., Поррас, П., Кабрера, Э., Льянес, Дж., Эрнандес, Дж., и другие. (1997).Las asociaciones maíz-leguminosas: su efecto en la conservación de la fertilidad de los suelos. Agronomía Mesoamericana 8, 65–73.

    Академия Google

    Аслам, А., Ахмад, З. З., Асгар, Х. Н., и Шахид, М. (2018). Влияние эндофитных бактерий, содержащих карбоангидразу, на рост и физиологические показатели пшеницы в условиях водного дефицита. Завод Изд. науч. 21, 244–255. дои: 10.1080/1343943X.2018.1465348

    Полнотекстовая перекрестная ссылка | Академия Google

    Бенто-Сильва, А., Patto, MCV, и do Rosário Bronze, M. (2018). Актуальность, структура и анализ феруловой кислоты в клеточных стенках кукурузы. Пищевая хим. 246, 360–378. doi: 10.1016/j.foodchem.2017.11.012

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Боланьос-Васкес, М.К., и Вернер, Д. (1997). Воздействие Rhizobium tropici, R. etli и R. leguminosarum bv. Phaseoli на флавоноиды, индуцирующие ген nod, в корневых экссудатах Phaseolus vulgaris. Мол. Растительный микроб.Междунар. 10, 339–346. doi: 10.1094/mpmi.1997.10.3.339

    Полнотекстовая перекрестная ссылка | Академия Google

    Бустаманте-Брито, Р., Вера-Понсе де Леон, А., Розенблют, М., Мартинес-Ромеро, Х. К., и Мартинес-Ромеро, Э. (2019). Метатранскриптомный анализ бактериального симбионта Dactylopiibacterium carminicum из карминового кошенильного кокка Dactylopius (Hemiptera: Coccoidea: Dactylopiidae). Жизнь 9:4. дои: 10.3390/life04

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Кадот, С., Guan, H., Bigalke, M., Walser, J.C., Jander, G., Erb, M., et al. (2021). Специфические и консервативные модели структурирования микробиоты бензоксазиноидами кукурузы в полевых условиях. Микробиом 9, 1–19. doi: 10.1186/s40168-021-01049-2

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Cardoso, EJBN, Nogueira, M.A., and Ferraz, SMG (2007). Биологическая фиксация N2 и минеральный N в совмещении между посевами фасоли и кукурузы или в посевах единственного урожая на юго-востоке Бразилии. Экспл. Агр. 43, 319–330.

    Академия Google

    Карвалье, Л. К., Деннис, П. Г., Федосеенко, Д., Хаджирезаи, М. Р., Боррис, Р., и фон Вирен, Н. (2011). Корневая экссудация сахаров, аминокислот и органических кислот кукурузой при дефиците азота, фосфора, калия и железа. J. Питательные вещества для растений. Почвовед. 174, 3–11. doi: 10.1002/jpln.201000085

    Полнотекстовая перекрестная ссылка | Академия Google

    Чапарро, Дж. М., Бадри, Д. В., Баккер, М. Г., Сугияма, А., Мантер, Д. К., и Виванко, Дж. М. (2013). Корневая экссудация фитохимических веществ у арабидопсиса следует определенным закономерностям, которые запрограммированы в процессе развития и коррелируют с микробными функциями почвы. PLoS One 8:e55731. doi: 10.1371/journal.pone.0055731

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Коттон, Т.Е.А., Петриак, П., Кэмерон, Д.Д., Мезельмани, М.А., Шварценбахер, Р., Рольфе, С.А., и соавт. (2019). Метаболическая регуляция ризобиома кукурузы бензоксазиноидами. ISME J. 13, 1647–1658. doi: 10.1038/s41396-019-0375-2

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    да Силва Лима, Л., Оливарес, Ф.Л., Де Оливейра, Р.Р., Вега, М.Р.Г., Агияр, Н.О., и Канеллас, Л.П. (2014). Профилирование корневого экссудата проростков кукурузы, инокулированных Herbaspirillum seropedicae и гуминовыми кислотами. Хим. биол. Технол. Агр. 1, 1–18. doi: 10.1186/s40538-014-0023-z

    Полнотекстовая перекрестная ссылка | Академия Google

    де Мендибуру, Ф.и де Мендибуру, М. Ф. (2019). Пакет «Сельскохозяйственные». Пакет R, версия, 1-2.

    Академия Google

    Экхардт, Т. (1978). Экспресс-метод идентификации плазмид дезоксирибонуклеиновой кислоты в бактериях. Плазмида 1, 584–588. дои: 10.1016/0147-619X(78)

    -1

    Полнотекстовая перекрестная ссылка | Академия Google

    Фальконе-Феррейра, М.Л., Риус, С.П., и Казати, П. (2012). Флавоноиды: биосинтез, биологические функции и биотехнологические применения. Фронт. Растениевод. 28:222. doi: 10.3389/fpls.2012.00222

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Фан, Б., Карвалье, Л. К., Беккер, А., Федосеенко, Д., фон Вирен, Н., и Боррис, Р. (2012). Транскриптомное профилирование Bacillus amyloliquefaciens FZB42 в ответ на экссудаты корней кукурузы. ВМС микробиол. 12:1–13. дои: 10.1186/1471-2180-12-116

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Фининса, К.(1996). Влияние совмещения фасоли с кукурузой на болезни фасоли бактериальным ожогом и ржавчиной. Междунар. Дж. Пешт. Управлять. 42, 51–54. дои: 10.1080/09670879609371969

    Полнотекстовая перекрестная ссылка | Академия Google

    Гастелум, Г., и Роча, Дж. (2020). Milpas как модель для изучения микробиоразнообразия и взаимодействия растений и микробов. TIP Revista Especializada en Ciencias Quimico-Biológicas 23, 1–13. doi: 10.22201/fesz.23958723e.2020.0.254

    Полнотекстовая перекрестная ссылка | Академия Google

    Гомес-Годинес, Л.Дж., Фернандес-Вальверде, С.Л., Мартинес Ромеро, Х.К., и Мартинес-Ромеро, Э. (2019). Метатранскриптомика и фиксация азота в ризоплане проростков кукурузы, инокулированных группой PGPR. Сист. заявл. микробиол. 42, 517–525. doi: 10.1016/j.syapm.2019.05.003

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гонсалес-Паредес, Ю., Аларкон, А., Феррера-Серрато, Р., Альмарас, Дж. Дж., Мартинес-Ромеро, Э., Крус-Санчес, Дж. С., и другие. (2013). Толерантность, рост и разложение фенантрена и бенз[а]пирена Rhizobium tropici CIAT 899 в жидкой культуральной среде. Заяв. Экологичность почвы. 63, 105–111. doi: 10.1016/j.apsoil.2012.09.010

    Полнотекстовая перекрестная ссылка | Академия Google

    Гутьеррес-Самора, М.Л., и Мартинес-Ромеро, Э. (2001). Естественная эндофитная ассоциация между Rhizobium etli и кукурузой ( Zea mays L.). Дж. Биотехнология. 91, 117–126. doi: 10.1016/s0168-1656(01)00332-7

    Полнотекстовая перекрестная ссылка | Академия Google

    Халлер Т. и Столп Х. (1985). Количественная оценка корневой экссудации растений кукурузы. Почва для растений. 86, 207–216. дои: 10.1007/BF02182895

    Полнотекстовая перекрестная ссылка | Академия Google

    Хассан, Х.М., и Трокселл, Б. (2013). Регуляция транскрипции регулятором поглощения железа (Fur) у патогенных бактерий. Фронт. Заражение клетки. микробиол. 3:59. doi: 10.3389/fcimb.2013.00059

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Уэрта-Сепас, Дж., Шклярчик, Д., Хеллер, Д., Эрнандес-Плаза, А., Форслунд, С.К., Кук, Х., и другие. (2019). eggNOG 5.0: иерархический, функционально и филогенетически аннотированный ресурс ортологии, основанный на 5090 организмах и 2502 вирусах. Рез. нуклеиновых кислот. 47, Д309–Д314. doi: 10.1093/nar/gky1085

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Hungria, M., Andrade, D.D.S., Colozzi-Filho, A., and Balota, EL. (1997). Interação entre microorganismos делать соло, feijoeiro е milho эм monocultura ou consórcio. Pesquisa Agropecuária Brasileira 32, 807–818.

    Академия Google

    Хайнс, М.Ф., и МакГрегор, Н.Ф. (1990). Две плазмиды, кроме клубеньковой плазмиды, необходимы для образования азотфиксирующих клубеньков Rhizobium leguminosarum. Мол. микробиол. 4, 567–574. doi: 10.1111/j.1365-2958.1990.tb00625.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Айер, Б., Раджпут, М.С., Джог, Р., Джоши, Э., Бхарвад, К., и Раджкумар, С. (2016). Опосредованное органическими кислотами подавление утилизации сахара у ризобий. Микробиолог. Рез. 192, 211–220. doi: 10.1016/j.micres.2016.07.006

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Джефферсон, Р. А. (1987). Анализ химерных генов у растений: система слияния генов GUS. Завод Мол. биол. 5, 387–405. дои: 10.1007/BF02667740

    Полнотекстовая перекрестная ссылка | Академия Google

    Джин М., Чжан X., Чжао М., Дэн М., Ду Ю., Чжоу Ю. и др. (2017). Интегрированное картирование на основе геномики раскрывает генетику, лежащую в основе биосинтеза флавоноидов кукурузы. BMC Растение Биол. 17:1–17. doi: 10.1186/s12870-017-0972-z

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Knee, E.M., Gong, F.C., Gao, M., Teplitski, M., Jones, A.R., Foxworthy, A., et al. (2001). Корневая слизь гороха и ее использование ризосферными бактериями в качестве единственного источника углерода. Мол. Растительный микроб. Междунар. 14, 775–784. doi: 10.1094/MPMI.2001.14.6.775

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Кокотек, В.и Вольфганг, Л. (1989). Конструирование кассеты устойчивости к lacZ-канамицину, пригодной для сайт-направленного мутагенеза и в качестве промоторного зонда. Ген 84, 467–471. дои: 10.1016/0378-1119(89)

    -2

    Полнотекстовая перекрестная ссылка | Академия Google

    Ку, Б.-Дж., Адриано, Д.К., Болан, Н.С., и Бартон, К.Д. (2005). «Корневые экссудаты и микроорганизмы», в Энциклопедии почв в окружающей среде , изд. Х. Даниэль (Эльзевир), 421–428. doi: 10.1016/B0-12-348530-4/00461-6

    Полнотекстовая перекрестная ссылка | Академия Google

    Крагелунд, Л., Хосбонд, К., и Найбро, О. (1997). Распределение метаболической активности и реакции на фосфатное голодание lux-меченых Pseudomonas fluorescens репортерных бактерий в ризосфере ячменя. Заяв. Окружающая среда. микробиол. 63, 4920–4928. doi: 10.1128/aem.63.12.4920-4928.1997

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Латати М., Пансу М., Древон Дж. Дж. и Оунане С. М. (2013). Преимущество промежуточного посева кукурузы ( Zea mays L.) и фасоли обыкновенной ( Phaseolus vulgaris L.) на урожайность и поглощение азота в Северо-Восточном Алжире. Междунар. Дж. Рез. заявл. науч. 1, 1–7.

    Академия Google

    Li, B., Li, Y.Y., Wu, H.M., Zhang, F.F., Li, C.J., Li, X.X., et al. (2016). Корневые экссудаты способствуют межвидовому облегчению, усиливая нодуляцию и фиксацию N2. Проц. Натл. акад. науч. США 113, 6496–6501. doi: 10.1073/pnas.1523580113

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ли, Л., Li, S.M., Sun, J.H., Zhou, L.L., Bao, X.G., Zhang, H.G., et al. (2007). Разнообразие повышает продуктивность сельского хозяйства за счет облегчения поступления фосфора в ризосферу на почвах с дефицитом фосфора. Проц. Натл. акад. науч. США 104, 11192–11196. doi: 10.1073/pnas.07045

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ли В., Чжао X., Цзоу С., Ма Ю., Чжан К. и Чжан М. (2012). Сканирующий анализ активности β-галактозидазы. Заяв. Биохим.микробиол. 48, 603–607. дои: 10.1134/S0003683812060075

    Полнотекстовая перекрестная ссылка | Академия Google

    Ляо, Ю., Смит, Г.К., и Ши, В. (2014). Подсчет признаков: эффективная программа общего назначения для присвоения чтений последовательностей геномным признакам. Биоинформатика 30, 923–930. doi: 10.1093/биоинформатика/btt656

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Лира-Сильва, Э., Сантьяго-Мартинес, М. Г., Эрнандес-Хуарес, В., Гарсия-Контрерас, Р., Морено-Санчес, Р., и Яссо-Чавес, Р. (2012). Активация метаногенеза кадмием у морских архей methanosarcina acetivorans. PLoS One 7:e48779. doi: 10.1371/journal.pone.0048779

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Лю Л.К., Беккер Д.Ф. и Таннер Дж.Дж. (2017). Структура, функция и механизм утилизации пролина А (PutA). Арх. Биохим. Биофиз. 632, 142–157. doi: 10.1016/j.abb.2017.07.005

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Лопес-Герреро, М., Орменьо-Оррильо, Э., Розенблют, М., Мартинес-Ромеро, Дж., и Мартинес-Ромеро, Э. (2013). Гипотеза буфета для микробного питания в ризосфере. Фронт. Растениевод. 4:188. doi: 10.3389/fpls.2013.00188

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Лопес-Герреро, М. Г., Орменьо-Оррильо, Э., Акоста, Х. Л., Мендоса-Варгас, А., Рогель, М. А., Рамирес, М. А., и соавт. (2012). Изменчивость, стабильность и экспрессия внехромосомного репликона ризобий в природных нишах. Плазмида 68, 149–158. doi: 10.1016/j.plasmid.2012.07.002

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Лопес-Ридаура, С., Барба-Эското, Л., Рейна-Рамирес, К.А., Сум, К., Паласиос-Рохас, Н., и Джерард, Б. (2021). Совмещение кукурузы в системе milpa. разнообразия, масштабов и важности для продовольственной безопасности в Западном нагорье Гватемалы. науч. Респ. 11, 1–10. doi: 10.1038/s41598-021-82784-2

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Лучт, Дж.М. и Бремер Э. (1994). Адаптация Escherichia coli к средам с высокой осмолярностью: осморегуляция высокоаффинной транспортной системы глицина-бетаина ProU. FEMS микробиол. Ред. 14, 3–20. doi: 10.1111/j.1574-6976.1994.tb00067.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Мари, К., Бротон, В.Дж., и Дикин, В.Дж. (2001). Системы секреции Rhizobium III типа: заклинатели бобовых или тревожные сигналы? Курс. мнение биол. растений 4, 336–342. doi: 10.1016/S1369-5266(00)00182-5

    Полнотекстовая перекрестная ссылка | Академия Google

    Мартинес Э., Паласиос Р. и Санчес Ф. (1987). Азотфиксирующие клубеньки, индуцированные Agrobacterium tumefaciens , содержащими плазмиды Rhizobium Phaseoli Phaseoli. J. Бактериол. 169, 2828–2834. doi: 10.1128/jb.169.6.2828-2834.1987

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Мартинес Э., Пардо М., Паласиос Р. и Севальос М.(1985). Повторение последовательностей генов фиксации азота и специфичность Rhizobium в отношении образования клубеньков и фиксации азота у Phaseolus vulgaris. J. Генерал микробиол. 131, 1779–1786 гг. дои: 10.1099/00221287-131-7-1779

    Полнотекстовая перекрестная ссылка | Академия Google

    Матус-Акунья, В., Кабальеро-Флорес, Г., и Мартинес-Ромеро, Э. (2021). Влияние генотипа кукурузы на ризосферное эукариотическое сообщество. FEMS микробиол. Экол. 97:fiab066. doi: 10.1093/femsec/fiab066

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Матус-Акунья, В., Кабальеро-Флорес, Г., Рейес-Эрнандес, Б.Дж., и Мартинес-Ромеро, Э. (2018). Бактериальные жертвы и комменсалы обуславливают воздействие нематод bacteriovorus на Zea mays и Arabidopsis thaliana. Заяв. Пачкаться. Экол. 132, 99–106. doi: 10.1016/j.apsoil.2018.08.012

    Полнотекстовая перекрестная ссылка | Академия Google

    Мендес-Флорес, О. Г., Очоа-Диас Лопес, Х., Кастро-Кесада, И., Оливо-Видаль, З. Э., Гарсия-Миранда, Р., Родригес-Роблес, У., и др. (2021). Милпа как поставщик биоактивных соединений: обзор. Food Rev. Int. 1–18. дои: 10.1080/87559129.2021.1934001

    Полнотекстовая перекрестная ссылка | Академия Google

    Моммер, Л., Киркегор, Дж., и ван Рейвен, Дж. (2016). Корневые взаимодействия: к ризосферному каркасу. Trends Plant Sci. 21, 209–217. doi: 10.1016/j.tplants.2016.01.009

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Монтес-Грахалес, Д., Эстуро-Эскофет, Н., Эскивель, Б., и Мартинес-Ромеро, Э. (2019).Экзометаболиты Phaseolus vulgaris-нодулятивные штаммы ризобий. Метаболиты 9:105. doi: 10.3390/metabo05

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Назари, М., Рибелинг, С., Банфилд, К.С., Акале, А., Кроста, М., и Мейсон-Джонс, К. (2020). Полисахаридный состав слизи и экссудация кукурузы из контрастных климатических регионов. Фронт. Растениевод. 11:1968. doi: 10.3389/fpls.2020.587610

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Новотный, И.П., Титтонелл П., Фуэнтес-Понсе М. Х., Лопес-Ридаура С. и Россинг В. А. (2021). Важность традиционной милпы для продовольственной безопасности и самообеспеченности питанием в горной местности штата Оахака, Мексика. PLoS One 16:e0246281. doi: 10.1371/journal.pone.0246281

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ньоки, Д., и Ндакидеми, П.А. (2018). Длина корня, образование клубеньков и биологическая азотфиксация инокулированной ризобиями сои ( Glycine max [L.] Merr.), выращенных под кукурузой ( Zea mays L.) в системах совмещения культур и внесения фосфорных и калиевых удобрений. Доп. био. 9, 173–180.

    Академия Google

    Пелле, Д.М., Грунес, Д.Л., и Кочиан, Л.В. (1995). Экссудация органической кислоты как механизм толерантности к алюминию у кукурузы ( Zea mays L.). Планта 196, 788–795. дои: 10.1007/BF00197346

    Полнотекстовая перекрестная ссылка | Академия Google

    Филлипс, Д. А., Фокс, Т. С., Кинг, М. Д., Бхуванешвари, Т.В., и Тойбер, Л.Р. (2004). Микробные продукты вызывают экссудацию аминокислот из корней растений. Завод физиол. 136, 2887–2894. doi: 10.1104/стр.104.044222

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Квандт, Дж., и Хайнс, М.Ф. (1993). Универсальные векторы-самоубийцы, которые позволяют осуществлять прямой отбор для замены генов в грамотрицательных бактериях. Ген 127, 15–21. дои: 10.1016/0378-1119(93)-6

    Полнотекстовая перекрестная ссылка | Академия Google

    Реболлар, Э.А., Сандовал-Кастельянос, Э., Ресслер, К., Гаут, Б.С., Алькарас, Л.Д., Бенитес, М., и соавт. (2017). Сезонные изменения в поликультуре, основанной на кукурузе, в центральной Мексике изменяют совместные сети почвенных бактериальных сообществ. Фронт. микробиол. 8:2478. doi: 10.3389/fmicb.2017.02478

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Робинсон, доктор медицины, Маккарти, Д.Дж., и Смит, Г.К. (2010). edgeR: пакет Bioconductor для анализа дифференциальной экспрессии цифровых данных экспрессии генов. Биоинформатика 26, 139–140. doi: 10.1093/биоинформатика/btp616

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Родригес-Робайо, К. Дж., Мендес-Лопес, М. Э., Молина-Вильегас, А., и Хуарес, Л. (2020). О чем мы говорим, когда говорим о милпе? Концептуальный подход к значению, темам исследований и влиянию системы майя милпа. J. Сельский конный завод. 77, 47–54. doi: 10.1016/j.jrurstud.2020.04.029

    Полнотекстовая перекрестная ссылка | Академия Google

    Ромеро-Штайнер, С., Parales, R.E., Harwood, C.S., and Houghton, J.E. (1994). Характеристика регуляторного гена pcaR из Pseudomonas putida, необходимого для полной деградации п-гидроксибензоата. J. Бактериол. 176:5771. doi: 10.1128/jb.176.18.5771-5779.1994

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Розенблют М., Хайнс М. Ф. и Мартинес-Ромеро Э. (1998). Гены Rhizobium tropiciteu, участвующие в специфическом поглощении соединений экссудата фасоли Phaseolus vulgaris. Мол. Генерал Жене. 258, 587–598. дои: 10.1007/s004380050772

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Розенблют, М., и Мартинес-Ромеро, Э. (2004). Популяции кукурузы Rhizobium etli и их конкурентоспособность при колонизации корней. Арх. микробиол. 181, 337–344. doi: 10.1007/s00203-004-0661-9

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Розенблют М., Орменьо-Орильо Э., Лопес-Лопес А., Rogel, M.A., Reyes-Hernandez, B.J., Martinez-Romero, J.C., et al. (2018). Азотфиксация злаков. Фронт. микробиол. 9:1794. doi: 10.3389/fmicb.2018.01794

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Рубиа М.И., Рамачандран В.К., Аррес-Игор К., Ларраинзар Э. и Пул П.С. (2020). Новый биосенсор для мониторинга пролина в экссудатах и ​​узелках корня гороха в условиях осмотического стресса и восстановления. Почва для растений. 452, 413–422. дои: 10.1007/с11104-020-04577-2

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Санталла, М., Родино, А.П., Каскеро, П.А., и Де Рон, А.М. (2001). Взаимодействия кустовой фасоли в междурядьях с полевой и сахарной кукурузой. евро. Дж. Агрон. 15, 185–196. doi: 10.1016/S1161-0301(01)00104-6

    Полнотекстовая перекрестная ссылка | Академия Google

    Сантьяго-Мартинес, М. Г., Энкалада, Р., Лира-Сильва, Э., Пинеда, Э., Галлардо-Перес, Х. К., Рейес-Гарсия, М. А., и другие.(2016). Питательный статус Methanosarcina acetivorans регулирует метаболизм гликогена и потоки глюконеогенеза и гликолиза. FEBS J. 283, 1979–1999. doi: 10.1111/февраль 13717

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Шамсельдин, А. (2007). Использование ДНК-маркера для отбора хорошо адаптированных штаммов Phaseolus-симбионтов к кислым условиям и высокой температуре. Биотехнология. лат. 29, 37–44. doi: 10.1007/s10529-006-9200-x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Сидоре, Т., Dinse, T., Öhrlein, J., Becker, A., and Reinhold-Hurek, B. (2012). Транскриптомный анализ ответов на экссудаты выявил гены, необходимые для ризосферной компетентности эндофита Azoarcus sp. штамм BH72. Окружающая среда. микробиол. 14, 2775–2787. doi: 10.1111/j.1462-2920.2012.02777.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Сильва-Навас, Дж., Морено-Рисуэно, М.А., Мансано, К., Паллеро-Баэна, М., Наварро-Нейла, С., Телес-Робледо, Б., и др. (2015).D-root: система выращивания растений с корнями в темноте или при различных условиях освещения. Завод J. 84, 244–255. doi: 10.1111/tpj.12998

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Сиркар, Д., и Митра, А. (2008). Доказательства образования п-гидроксибензоата с участием ферментативного расщепления боковой цепи фенилпропаноида в волосатых корнях Daucus carota. J. Физиол растений. 165, 407–414.

    Академия Google

    Таварая, К., Хорие Р., Сайто С., Вагацума Т., Сайто К. и Ойкава А. (2014). Метаболитный профиль корневых выделений фасоли обыкновенной в условиях дефицита фосфора. Метаболиты 4, 599–611. doi: 10.3390/metabo4030599

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Vacheron, J., Desbrosses, G., Bouffaud, M.L., Touraine, B., Moenne-Loccoz, Y., Muller, D., et al. (2013). Стимулирующие рост растений ризобактерии и функционирование корневой системы. Фронт. Растениевод. 4:356. doi: 10.3389/fpls.2013.00356

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    van Dillewijn, P., Soto, M.J., Villadas, P.J., and Toro, N. (2001). Создание и выпуск в окружающую среду штамма Sinorhizobium meliloti, генетически модифицированного, чтобы быть более конкурентоспособным в отношении образования клубеньков люцерны. Заяв. Окружающая среда. микробиол. 67, 3860–3865. doi: 10.1128/AEM.67.9.3860-3865.2001

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    ВанДрис, К.М. и Эскаланте-Семерена, Дж. К. (2018). В Salmonella enterica OatA (ранее YjgM) использует O-ацетил-серин и ацетил-КоА для синтеза N,O-диацетилсерина, который активирует биосинтез цистеина. Фронт. микробиол. 9:2838. doi: 10.3389/fmicb.2018.02838

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Вора, С. М., Анкати, С., Патоле, К., Подиле, А. Р., и Арчана, Г. (2021). Изменения первичных метаболитов в корневых экссудатах совмещенного cajanus cajan-zea mays модулируют адаптацию и протеом энзифера (Sinorhizobium) fredii NGR234. Микроб. Экол. doi: 10.1007/s00248-021-01818-4 [Epub перед печатью].

    Полнотекстовая перекрестная ссылка | PubMed Резюме | Академия Google

    Wilson, K.J., Sessitsch, A., Corbo, J.C., Giller, K.E., Akkermans, A.D., and Jefferson, R.A. (1995). Транспозоны β-глюкуронидазы (GUS) для экологических и генетических исследований ризобий и других грамотрицательных бактерий. Микробиология 141, 1691–1705. дои: 10.1099/13500872-141-7-1691

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Райт, В., Литтл Дж., Лю Ф. и Чакраборти Р. (2013). Выделение и структурная идентификация тригидроксаматного сидерофора вицибактина и продуктов его деградации из Rhizobium leguminosarum ATCC 14479 bv. трехлистный. Биометаллы 26, 271–283. doi: 10.1007/s10534-013-9609-3

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Кси, К., Ламбрехт, М., Вандерлейден, Дж., и Михильс, Дж. (1999). Бифункциональные gfp- и gusA-содержащие производные мини-транспозона Tn5 для комбинированных исследований экспрессии генов и бактериальной локализации. J. Microbiol. Методы 35, 85–92. doi: 10.1016/s0167-7012(98)00103-1

    Полнотекстовая перекрестная ссылка | Академия Google

    Се, С., Ву, Х., Чен, Л., Занг, Х., Се, Ю. и Гао, X. (2015). Профилирование транскриптома Bacillus subtilis OKB105 в ответ на проростки риса. ВМС микробиол. 15:1–14. doi: 10.1186/s12866-015-0353-4

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ян С., Ду Х., Ву Ф., Ли Л., Ли С. и Мэн З.(2014). Протеомное понимание основ межвидового облегчения кукурузы (Zea mays) при совмещении бобов конских (Vicia faba) и кукурузы. Дж. Прот. 109, 111–124. doi: 10.1016/j.jprot.2014.06.027

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чжан, К., Постма, Дж. А., Йорк, Л. М., и Линч, Дж. П. (2014). Поиск корней дает преимущество в урожайности, зависящее от комплементарности ниши, в древней поликультуре «трех сестер» (кукуруза/фасоль/тыква). Энн.Бот. 191, 1719–1733.

    Академия Google

    Zhang, H., Yang, Y., Mei, X., Li, Y., Wu, J., Li, Y., et al. (2020). Фенольные кислоты, выделяющиеся в ризосфере кукурузы при совмещении кукурузы и сои, ингибируют фитофтороз сои. Фронт. Растениевод. 11:886. doi: 10.3389/fpls.2020.00886

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Zhang, N., Yang, D., Wang, D., Miao, Y., Shao, J., Zhou, X., et al. (2015). Полный транскриптомный анализ полезной для растений ризобактерии Bacillus amyloliquefaciens SQR9 во время усиленного образования биопленки, регулируемого корневыми экссудатами кукурузы. BMC Геном. 16:1–20. doi: 10.1186/s12864-015-1825-5

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чжао, К., Фан, З., Коултер, Дж. А., Инь, В., Ху, Ф., Ю, А., и соавт. (2020). Высокая плотность кукурузы снижает ингибирующее действие почвенного азота на посев гороха. Агрономия 10:248. doi: 10.3390/agronomy10020248

    Полнотекстовая перекрестная ссылка | Академия Google

    Если вы направляете свет в зеркало, означает ли тот факт, что свет отражается обратно, что вы фактически удваиваете количество света в комнате? Если да, то нельзя ли хотя бы частично решить энергетическую проблему, заполнив комнаты зеркалами? Если нет, то почему? | Примечания и вопросы


    SPEULATIVE SCIENCE

    Если вы направите свет в зеркало, означает ли тот факт, что свет отражается обратно, что вы эффективно удваиваете количество света в комнате? Если да, то нельзя ли хотя бы частично решить энергетическую проблему, заполнив комнаты зеркалами? Если нет, то почему?

    Марк Ллойд, Бат, Великобритания

    • Комната, облицованная зеркалами, будет более ярко освещена, чем комната, облицованная обычной смесью обоев, дерева, окон и т. д.Зеркала будут отражать большую часть падающего на них света обратно в комнату, тогда как обои поглощают большую часть падающего на них света. Это означало бы, что кто-то, читающий Guardian в зеркальной комнате с 60-ваттной лампочкой, увидит, что страница освещена более ярко, чем в обычной комнате с такой же лампочкой. Однако разница была бы незначительной, если бы комната, как обычно, была обставлена ​​стульями, коврами, кошками и т. д. Это имело бы еще меньшее влияние на энергетический кризис, поскольку много энергии тратится на такие вещи, как приготовление пищи, уборка, компьютеры и т. д. и т.п.и не только для освещения.

      Робин Уилсон,

    • Хотя на самом деле вы можете не удвоить свет, ваши глаза получают два, а то и больше света, поэтому комната кажется светлее. Раньше свечи и лампы часто имели за собой полированные металлические отражатели или устанавливались перед зеркалами именно для этого эффекта помещение казалось светлее без лишних затрат и тепла (свечи и масляные лампы выделяют довольно много тепла)

      Susan Deal , Шеффилд, Великобритания

    • Да, эта технология используется в маяках, большинстве фонариков и фарах ваших автомобилей.Вы не создаете больше света, как уже было сказано, а просто перенаправляете его обратно в пространство, которое хотите осветить.

      Лиз, Самоя, США

    • Комбинация (AgNO3 + Nh4 + C12h32O11 + NaOH) создает отражающую абсорбирующую поверхность, способную создавать прямо противоположное изображение при обзоре на 180°. В зависимости от точки зрения отдельного зрителя будет казаться, что он может видеть такое расстояние, как физически. В этих областях поверхности есть то, что позволяет свету поглощать и отражать, излучая более широкий диапазон света, создавая при этом видимость «большего» света.

      Zyan Kol, Пумбайя Мальта

    Добавьте свой ответ

    Педагогический колледж меняет название, чтобы лучше отражать свои предложения


    Педагогический колледж Университета штата Уичито изменил свое название на Колледж прикладных исследований. Изменение было внесено, чтобы лучше отразить широкий спектр образовательных и предложения по прикладному обучению, которые предоставляет колледж.

    Кроме того, Департамент учебной программы и обучения колледжа теперь является Школой. образования.

    Попечительский совет Канзаса утвердил изменение названия на своем заседании сегодня (среда, 20 июня).

    На протяжении всей своей истории колледж рос и менялся, чтобы решать задачи готовит профессионалов для все более сложного и специализированного мира, говорит Дин Ширли Лефевер.

    Колледж расширился за счет не только подготовки учителей и педагогических лидеры, но и консультанты, педагоги-психологи, спортивные тренеры и профессионалы в спортивном менеджменте и науке о физических упражнениях.

    «Новое название колледжа позволит нам сообщить о широте программ и возможности, которые мы предлагаем студентам и отраслевым партнерам, а также акцент мы делаем упор на прикладное обучение, где опыт решает все», — говорит Лефевер.

    Удовлетворение потребностей промышленности и рабочей силы

    Все программы колледжа заслужили успешную репутацию благодаря привлечению студентов в высококачественном, увлекательном, прикладном учебном опыте, готовя их к удовлетворить потребности в рабочей силе и отрасли.

    Новые имена более содержательны, поскольку они представляют весь спектр деятельности колледжа.

    «Мы хотим, чтобы преподаватели, сотрудники и студенты, не ориентированные на педагогическое образование, майоры воспринимают новое название как дополнительное подтверждение их важности в колледже, в то время как те, кто занимается педагогическим образованием и другими специальностями, связанными с образованием, продолжают чувствовать себя высоко ценится как часть нашей школы образования», — говорит Лефевер.

    Поддержание сильной идентичности

    Ким Макдауэлл, глава Департамента учебной программы и обучения, произносит название изменение ее программы дает преподавателям-педагогам возможность поддерживать сильную идентичность как кафедра подготовки учителей.

    «Наше новое название позволяет нам продемонстрировать разнообразие программ подготовки преподавателей, размещенных в нашем отделе и позволяет нам быть более узнаваемыми для тех, кто ищет программа подготовки учителей онлайн», — говорит Макдауэлл.

    Еще одно дополнительное преимущество заключается в том, что более широкое и всеобъемлющее имя может также открывать новые возможности для внешнего партнерства.

    С 1895 года, когда колледж был известен как Нормальное отделение, в нем и успешная история подготовки учителей и лидеров образования посредством высококачественных, программы, отмеченные наградами.

    Это не изменится.

    «Что изменится, — говорит Лефевер, — так это возможность продвигать и лучше отмечать успех всех наших программ в колледже.”

    ежедневных пошаговых инструкций в App Store

    — «Когда ты размышляешь, это действительно шанс дать волю своим чувствам и не прятаться.
    Я делаю это каждый день и каждую ночь, потому что тогда, когда я просыпаюсь, я не испытываю стресса, а когда ложусь спать, я» Я спокоен и чувствую себя лучше, поэтому я действительно рекомендую это приложение, и оно работает».

    — «Это очень расслабляющее приложение! Оно может помочь поразмышлять о том, что вы сделали в этот день.
    В целом, я люблю это приложение! Спасибо за создание этого замечательного приложения.»

    — «Это прекрасный способ перейти от негативного диалога к более позитивному»

    — «Помогло мне заглянуть внутрь себя и найти корень большинства моих проблем.
    Удивительное приложение.»

    Reflect — это личный журнал для размышлений, который разумно помогает вам фиксировать свои мысли и чувства и позволяет вам переключиться на более позитивный взгляд.
    Будьте более сосредоточенными и самосознательными. Откройте для себя новые способы быть более любящими , подлинный и мужественный.

    С Reflect Journal вы привыкнете проверять себя каждый день. Запишите, как вы себя чувствуете. Найдите время, чтобы глубже подумать о том, что важно для вас.
    Reflect разумно направляет ваши размышления со структурой, темами и вопросами.

    Это единственное в своем роде приложение использует запатентованную модель поведенческих компетенций, чтобы помочь вам. Модель основана на методах и практиках ориентированного на решение коучинга, теориях развития лидерства, CBT и позитивной психологии.

    Ведение дневника — один из лучших инструментов, который вы можете использовать, чтобы соединиться с самим собой и очистить свой разум.
    С журналом Reflect вы получаете преимущества внимательного ведения дневника:
    • Получайте темы с вопросами для размышлений
    • Получайте информацию о том, что важно для вас сейчас
    • Расширяйте возможности своих действий каждый день
    • Откройте для себя позитивный взгляд на повседневные жизненные ситуации
    • Учитесь быть благодарным.
    • Будьте более активными и целеустремленными
    • Освободитесь от негативных мыслей и моделей поведения
    • Развивайте и культивируйте новые точки зрения и взгляды
    • Обретите ясность и уверенность в себе
    • Объедините мысли, чувства и поведение
    • Получите больше контроля над ваша жизнь
    • Посмотрите на вещи с разных точек зрения
    • Переключитесь с негативного на позитивное мышление
    • Улучшите свое психическое здоровье

    Reflect Journal также можно использовать как инструмент для самопомощи и самосовершенствования.

    Журнал Reflect позволяет:
    • Ежедневно проверять себя
    Привыкайте ежедневно обращать внимание на свои мысли и чувства.
    • Погружайтесь глубже
    Получите разумно предложенные темы для размышлений, чтобы задать себе более глубокие вопросы.
    • Библиотека тем для самоанализа с вопросами и источниками вдохновения
    Получите постоянно растущую коллекцию полезных тем и вопросов. Имейте место, чтобы записывать свои мысли, замечать свои чувства и обдумывать новое поведение.Используйте управляемые рефлексивные вопросы, чтобы открыть для себя новые точки зрения и подходы к жизненным ситуациям.

    ЦЕНЫ И УСЛОВИЯ ПОДПИСКИ
    Журнал Reflect предлагает два варианта автоматического продления подписки для Reflect Premium:
    Ежемесячно — 5,99 долл. США в месяц
    Годовая — 17,99 долл. США в год — Предложение «Оставайтесь дома»

    Reflect Premium предоставляет:
    • Разблокируйте и используйте полный набор тем для журналов.
    • Регулярно добавляйте новые темы для журналов.

    Оплата будет снята с вашей учетной записи Apple ID при подтверждении покупки.Подписка продлевается автоматически, если она не будет отменена как минимум за 24 часа до окончания текущего периода. С вашего аккаунта будет взиматься плата за продление в течение 24 часов до окончания текущего периода. Вы можете управлять своими подписками и отменять их, перейдя в настройки своей учетной записи в App Store после покупки.

    Журнал Reflect также предлагает пожизненную подписку, которая оплачивается разовым авансовым платежом в размере 79,99 долларов США с неограниченным доступом к полной библиотеке тем для журналов навсегда.

    Цены указаны для клиентов из США. Цены в других странах могут отличаться, и фактические расходы могут быть конвертированы в вашу местную валюту в зависимости от страны проживания.

    Ознакомьтесь с условиями и положениями здесь:
    https://www.ensparkle.app/terms-of-use

    Ознакомьтесь с политикой конфиденциальности здесь:
    https://www.

    Написать ответ

    Ваш адрес email не будет опубликован.