Какая экспрессия какой типаж: Какой типаж, какой вкус, какая… — Burger King Россия

Содержание

СРАВНЕНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ ОПУХОЛЕВЫХ КЛЕТОК ДО ЛЕЧЕНИЯ И ПОСЛЕ КОНСТАТАЦИИ РЕЦИДИВА МНОЖЕСТВЕННОЙ МИЕЛОМЫ (КРАТКИЙ ОБЗОР И ОПИСАНИЕ КЛИНИЧЕСКОГО СЛУЧАЯ) | Сергеева

Введение

Множественная миелома (ММ) относится к злокаче­ственным заболеваниям системы крови с клональной пролиферацией плазматических клеток. Патогенез ММ представляет собой многоступенчатый процесс трансформации генетического материала клетки, ко­торый изучен лишь частично [1]. Молекулярно-ци­тогенетическое исследование клеток костного мозга у больных ММ является рутинным методом обсле­дования, по результатам которого проводится стра­тификация больных на группы риска и стадирование ММ. При цитогенетическом исследовании определя­ются: транслокации с вовлечением локуса генов IGH 14-й хромосомы, наличие трисомий по целому ряду нечетных хромосом, делеция короткого плеча 17-й хромосомы, моносомия или делеция длинного плеча 13-й хромосомы (del13q) и амплификация локуса 1q21 (amp1q21) [2]. Наряду с этим для тестирования точеч­ных мутаций в генах, ассоциированных с развитием ММ, широко используется метод секвенирования по Сэнгеру, позволяющий получать надежные резуль­таты при анализе последовательности ДНК на пред­мет единичных нуклеотидных замен, микроделеций и микроинсерций коротких участков длиной от одного нуклеотида до нескольких десятков оснований. Одна­ко этот метод пригоден только для анализа мутаций, носящих клональный характер или присутствующих в субклонах, составляющих не менее 10 % от общей опухолевой массы. Исследования с использованием современных методов секвенирования показали высо­кую гетерогенность различных генетических наруше­ний при ММ [3, 4].

По данным, полученным на большой выборке боль­ных с использованием секвенирования полного эк- зома (whole exome sequencing, WES), наиболее часто встречающимися нарушениями у больных ММ явля­ются точечные мутации в генах сигнального MAPK- пути (N-RAS, K-RAS, BRAF) и онкосупрессора ТР53, которые суммарно встречаются примерно у половины больных [5].

В патогенезе ММ нарушается регуляция транс­крипции целого ряда генов, таких как C-MYC, MMSET (NSD2), CCND1, CCND2, CKS1B, Notch3, IL-6, MDM2. В результате появляется понятие «профиля» экспрес­сии генов, различные варианты которого могут иметь прогностическое значение, определяя характер тече­ния заболевания и его резистентность к терапии [6].

Гены семейства RAS. Гены семейства RAS — наибо­лее часто мутирующие гены при ММ. В исследовании W. Chng и соавт. [7] частота встречаемости мутаций генов семейства RAS составила 23 % (102/561), из них у 74 (17 %) были выявлены мутации в гене N-RAS, у 28 (6 %) — в гене К-RAS. Большинство мутаций было детектировано в кодоне 61-го гена N-RAS (64 из 74). По данным литературы [8], активирующие миссенсмутации в генах N-RAS и К-RAS изменяют свойства соответствующих белков и превращают протоонкоге­ны в онкогены. Функциональная нагрузка таких му­таций заключается в том, что белки RAS теряют ГТФазную активность, вследствие чего нарушается их нормальная регуляция цитокинами в передаче митоген-активирующего сигнала к ядру, что приводит к по­вышенной пролиферации клеток [8]. Стадия, предше­ствующая ММ, моноклональная гаммапатия неясного генеза (МГНГ), на молекулярном уровне отличается от ММ отсутствием мутаций в генах семейства RAS [9]. Имеющиеся в литературе сведения о роли акти­вирующих мутаций в генах K-RAS и N-RAS в патоге­незе ММ весьма противоречивы. По одним данным, они считаются фактором неблагоприятного прогноза, ассоциируются с прогрессией заболевания и меньшей общей выживаемостью, по другим — могут влиять только на резистентность к терапии определенными препаратами (например, бортезомибом) [7, 10, 11].

BRAF. Киназа BRAF передает сигнал от RAS бел­ков к нижестоящим эффекторным белкам сигнально­го пути МАРК. Частота мутаций в гене BRjAF при ММ варьирует от 4 до 14,9 % [12]. Чаще всего встречает­ся активирующая мутация в 600-м кодоне с заменой валина на глютаминовую кислоту (V600E). Показано [13], что эта мутация ассоциируется с клинически бо­лее агрессивным течением ММ, более низкими пока­зателями общей выживаемости, а также с высокой ча­стотой (>50 %) выявления экстрамедуллярных очагов.

TP53. Опухолевый супрессор p53 является транс­крипционным фактором. Этот белок связывается с промоторами различных генов и может как активи­ровать, так и ингибировать их транскрипцию. Белок p53 вовлечен в репликацию и репарацию ДНК. От­сутствие гена ТР53 ведет к развитию синдрома Ли — Фраумени, проявляющегося предрасположенностью к отдельным новообразованиям и возникновению пер­вично-множественных опухолей [14]. Известен спектр нарушений, ведущих к дисфункции белка p53. Сюда относятся мутации гена TP53, метилирование его регу­ляторных областей, нарушение транспорта белка p53 в ядро, амплификация ингибитора p53 белка mdm2, связывание с вирусным белком E6, которое ведет к деградации p53 [14]. Кроме того, при делеции ко­роткого плеча хромосомы 17 (p17del) одна копия гена утрачивается полностью. Инактивация белка p53 счи­тается универсальным изменением в опухолевой клет­ке и встречается в 50—60 % новообразований. В основ­ном генные нарушения встречаются в гетерозиготном состоянии, представлены миссенс-мутациями, приво­дящими к аминокислотным заменам, и затрагивают чаще всего ДНК-связывающий домен. В результате подобных мутаций происходит изменение вторичной структуры белка и появление новых свойств, таких как способность активировать экспрессию некоторых генов, к которым относятся с-MYC, CCND1, MRD1. Усиление экспрессии MRD1 связано с появлением множе­ственной лекарственной устойчивости у клеток опухо­ли [15].

с-MYC. Протоонкоген с-MYC задействован во многих путях передачи сигналов от рецепторных комплексов на поверхности мембраны клетки. Его экспрессия на­ходится под контролем целого набора транскрипцион­ных регуляторов [16]. Белок c-myc вовлечен в большое число внутриклеточных взаимодействий, его повы­шенная экспрессия ассоциирована с начальными ста­диями неопластической трансформации клеток и уси­лением их пролиферации [17]. В спектр функций c-myc входит регуляция внутриклеточных систем энергообе­спечения — гликолиза, метаболизма глютамина и би­огенеза митохондрий, которые приводят к аккумуля­ции энергии для репликации ДНК и деления клетки [18]. Повышенная экспрессия этого белка ассоцииру­ется с геномной нестабильностью, вызываемой стиму­ляцией митохондрий, которая приводит к наработке активных форм кислорода [19], и в частности может быть связана с появлением транслокаций [20].

MMSET (NSD2). Белок MMSET (multiple myeloma SET domain) является гистонметилтрансферазой и принимает участие в реорганизации хроматина. Его повышенная экспрессия наблюдается на началь­ных стадиях патогенеза ММ. Транслокация с участи­ем гена MMSET t(4;14) является фактором неблаго­приятного прогноза. Искусственная репрессия белка MMSET приводит к пониженному темпу пролифера­ции, индукции апоптоза и клеточной агдезии [21].

CCND1 и CCND2. Высококонсервативные белки из семейства D-циклинов, CCND1 и CCND2, пред­ставляют собой регуляторные субъединицы киназ, необходимые для перехода клетки из G1 в S-фазу кле­точного цикла. Эти белки взаимодействуют с опухоле­вым супрессором Rb, и их экспрессия положительно регулируется Rb. Результатом ранних событий в пато­генезе множественной миеломы, таких как IGH-транс­локации, появление гипердиплоидности и трисомии, является гиперэкспрессия этих циклинов [22].

CKS1B. Увеличение экспрессии гена субъединицы 1В циклинкиназы является фактором неблагоприятного прогноза при ММ. Функция CKS1B заключается в ак­тивации циклина через его фосфорилирование [23]. Ген расположен на длинном плече 1-й хромосомы, его амплификация регулярно встречается среди генетиче­ских нарушений множественной миеломы [24].

Notch3. Белки семейства Notch вовлечены в регу­ляцию гемопоэза. Отсутствие белков этого семейства ведет к нарушению поздних стадий дифференцировки В-клеток [25]. Нарушение регуляторных механизмов работы рецепторов или их лигандов, входящих в сиг­нальный путь Notch, исследовано в различных типах злокачественных солидных и гематологических опу­холей, в том числе и при ММ. Ингибирование Notch индуцирует апоптоз в клетках опухоли, уменьшает устойчивость к лекарственным препаратам, изменяет характеристики миграции/рециркуляции плазма­тических клеток и их обновление [26]. Notch может участвовать в прогрессии ММ, увеличивая уровень интерлейкина-6 (IL-6), одного из ключевых факторов, стимулирующих клеточную пролиферацию [27].

Интерлейкин-6. Представляет собой цитокин плей- отропного действия. Он индуцирует дифференцировку и рост разных типов клеток, в том числе дифференцировку нормальных B-клеток в плазматические клетки, производящие антитела. Пролиферативная активность клеток множественной миеломы зависит от IL-6, осуществляющего ее аутокринную регуляцию [28]. Экспрессия IL-6 ассоциирована с агрессивным течением заболевания, высоким пролиферативным индексом и устойчивостью к лекарственным препара­там, запускающим апоптоз [29]. Повышение активно­сти IL-6 связано с остеодеструкцией — повышенной активностью и пролиферацией остеокластов и пони­жением количества остебластов при ММ [30]. Высо­кий уровень экспрессии IL-6 является фактором пло­хого прогноза при ММ.

MDM2 (murine double minute 2) — белок ингибитор TP53. Изначально ген этого белка был идентифи­цирован в экстрахромосомной ДНК, образующейся в раковых клетках. Его взаимодействие с TP53 ве­дет к тому, что комплекс MDM2/TP53 направляется из ядра в цитоплазму, где подвергается убиквитинированию. В условиях стресса сайты связывания MDM2 и TP53 фосфорилируются, и комплекс, в ко­тором TP53 не активен, не образуется. В результате белок TP53 переходит из латентной формы в активи­рованную форму, запускает процессы остановки кле­точного цикла и апоптоза. Гиперэкспрессия MDM2 — типичный механизм разоружения раковой клетки, лишающий ее защитных функций опухолевого су­прессора TP53 [31].

Цель исследования — проанализировать молеку­лярно-генетический статус опухоли у больного ММ с коротким периодом ремиссии в дебюте и рецидиве заболевания и сопоставить с клиническим течением заболевания.

Материалы и методы

Пункцию костного мозга для молекулярно-генети­ческого скрининга (fluorescence in situ hybridization (FISH), измерение экспрессии и мутационный статус генов) проводили дважды — в дебюте и рецидиве ММ.

Для оценки значимости изменения величин экс­прессии генов регуляторных белков у больного ММ в дебюте и рецидиве заболевания сравнивали их с со­ответствующими показателями для клеток CD138+, по­лученных от 10 доноров (5 женщин, 5 мужчин в возра­сте от 25 до 41 года). Если значение экспрессии гена у больного вписывалось в диапазон значений, харак­терных для доноров, считали, что оно находится в пре­делах нормы.

Выделение мононуклеаров из костного мозга и CD138-кле­ток. Используя градиент плотности фиколла (1,077 г/ см3), из костномозговой взвеси выделяли фракцию мононуклеаров. В дальнейшем проводилась высоко­активная магнитная сепарация согласно протоколу Miltenyi Biotec (Miltenyi Biotec GmbH, Germany, http://www.miltenyibiotec.com) с использованием магнитного сепаратора OctoMacs, антител anti-CD138, конъюги­рованных с 50-нм частицами оксида железа и анти­тел anti-CD138, конъюгированных с фикоэритрином. Чистота выделения мононуклеаров, обогащенных С0138

+-клетками, в дебюте (установка диагно­за 29.05.2013) и прогрессии (констатация рецидива 01.08.2014) составила 80 и 70 % соответственно. В даль­нейшем полученные мононуклеары и С0138+-клетки использовали для проведения FISH-исследования, из­мерения уровня экспрессии генов и определения мута­ционного статуса генов.

Флуоресцентная гибридизация in oitu (FISH). Молеку­лярно-цитогенетическое исследование клеток костно­го мозга выполняли в лаборатории кариологии ФГБУ «НМИЦ гематологии» Минздрава России. В дебюте заболевания FISH-исследование проводилось на моно- нуклеарах костного мозга для выявления первичных (t(14q32)/IGH, множественные трисомии) и вторичных (del 17p13/TP53, del13q14/-13, del1p32, amp1q21 и t(8q24)/ cMYC) хромосомных аномалий. В прогрессии заболе­вания на сепарированных С0138

+-клетках проводил­ся повторный FISH-анализ с ДНК-зондами для вы­явления del17p13/TP53, del13q14/-13, del1p32, amp1q21, t(8q24)/cMYC и множественных трисомий. В работе использовали различные центромерные и локус-спе- цифичные ДНК-зонды: XL IGHplus, XL P53, XL cMYC BA, XL 1p32/1q21, XL 5p15/9q22/15q22 Hyperdiploidy Amplification Probe (MetaSystems, Germany) и D13S25 (Cytocell, UK). Исследование проводили согласно про­токолам производителей. Для каждого зонда анализи­ровали по 200 интерфазных ядер с четкими сигналами. Результаты FISH-анализа описывали в соответствии с международной номенклатурой (International System for Cytogenetic Nomenclature, ISCN, 2013) [32].

Анализ экспрессии генов. Тотальную фракцию РНК выделяли из плазматических клеток костного мозга с поверхностным маркером CD138+ при помощи лизи­са в гуанидин-изотиоцианатном буфере с последую­щей очисткой стандартным фенол-хлороформным ме­тодом. Полученную РНК хранили при температуре —70 °С в EtOH. Для анализа экспрессии генов исполь­зовали метод секвенирования РНК нового поколения (RNA-seq). Анализ проводили на приборе Illumina HiSeq (Illumina, США) с использованием наборов для подготовки библиотеки транскриптома тоталь­ной РНК (Whole-transcriptome analysis with total RNA sequencing). Выравнивание полученных после секвенирования последовательностей на референсный геном и сборка транскриптома проводилось с помо­щью программного обеспечения STAR [33]. Пересчет уровня экспрессии генов был выполнен в программе DESeq2. Числовые значения экспрессии (normalized gene counts, ngc) представляют собой абсолютные значения, полученные при сборке и выравнивании транскрипта гена на последовательность референс- ного гена с последующим нормированием на глубину секвенирования [34]. Для определения значимости различий между экспрессией в опухолевых клетках в дебюте и рецидиве заболевания полученные зна­чения приведены с меньшим и большим диапазоном значений экспрессии в плазматических клетках 10 до­норов (табл. 1).

 

Таблица 1. Изменения уровня экспрессии генов в дебюте ММ и при констатации рецидива у больного в сравнении со значениями экспрессии этих генов у доноров

Table 1. Gene expression fold changes are at the time of diagnosis and progression in comparison with a range of gene expression values for a group of donors

Гены

Genes

Доноры (n = 10) Donors (n = 10)

Больной

Patient

минимальное значение, ngc

min value, ngc

максимальное значение, ngc

max value, ngc

дебют заболевания, ngc

disease debut, ngc

рецидив заболевания, ngc

disease relapse, ngc

с-myc

188

493

1374

2074

CCND1

5

981

117

12

CCND2

332

4592

4383

613

MMSET(NSD2)

611

1608

338

1195

Notch3

945

2276

1763

5805

CKS1B

4

40

17

29

IL6

2

41

33

953

TP53

166

479

237

210

MDM2

384

910

1821

4458

RAF1

706

1395

791

1710

STAT4

22

143

46

145

mTOR

456

723

625

1585

Клональные IGH/L

Сlonal IGH/L

IGHG2

35146

280485

628255

67532

IGHM

46047

279812

2118

298

IGHV3-33

811

11080

13954

1246

IGLC2

25465

126208

242255

22381

IGLV1-44

1460

6682

21176

1491

Неклональные IGH

Non-clonal IGH

IGHV3-23

8970

48891

940

14

IGHV2-5

3204

15381

1613

36

Примечание. ngc — normalized gene counts, единица измерения экспрессии гена, выраженная в количестве прочтений гена, нормированного на общее число прочтений в образце.

Note. ngc — normalized gene counts (units of given values).

 

Анализ соматических мутаций. Соматические мута­ции в геномной ДНК плазматических клеток CD138+ костного мозга анализировали методом секвенирования по Сэнгеру. В данной работе исследовались кодирующие области генов N-RAS, K-RAS, TP53, и экзон 15 гена BRAF. Геномную ДНК выделяли ме­тодом фенол-хлороформной экстракции. Клетки лизировали в 1 мл STE (Sodium Chloride-Tris-EDTA) буфера, содержащего 1 % додецлсульфат натрия (SDS) и протеиназу К (200 мкг/мл), в течение ночи при 37 °С или двух часов при 60 °С с последующей фенольной экстракцией.

Для постановки полимеразной цепной реакции (ПЦР) использовали смесь PCR Master Mix (2X) Thermo Scientific™, 0,01—0,02 мкг геномной ДНК и 10 пкмоль каждого из праймеров в усредненных условиях (94 °С — 1 мин., 60—62 °С — 1 мин., 72 °С — 1—2 мин., 30 циклов). Все праймерные системы и зонды являются оригинальными и разработаны в ходе прове­дения данного исследования. Для гена BRAF праймеры были синтезированы для 15-го экзона: прямой прай­мер BRAF15D: gatctcttacctaaactcttca; обратный праймер BRAF15R: ccttcaatgactttctagtaact, для гена NRAS и KRAS праймеры были подобраны таким образом, чтобы ам- плифицировать 2, 3 и 4-й экзоны обоих генов: RAS1D: atgtggctcgccaattaacc и RAS1R tgggtaaagatgatccgacaa; RAS1: cccttaccctccacaccccc; RAS2 ctcatttccccataaagattcag; NRAS3x: ttcaagcagtctgccctcct; NRAS4: aactgatgcaaactcttgcaca; KRASD1: gatacacgtctgcagtcaac; KRASR1: tcctgcaccagtaatatgcat; KRASD2: ccagactgtgtttctcccttg; KRASR2: ttactccactgctctaatccc; KRAS3: gacaaaagttgtggacaggtt; KRAS4:ggacactggattaagaagcaa. Все ко­дирующие экзоны TP53, кроме 11-го, были включены в анализ и амплифицировались с использованием сле­дующих праймеров: TP53D1: gccgagctgtctcagacact; TP53R1: gaggaatcccaaagttccaaacaa; TP53D2: acg ccaactctctctagctc; TP53R2: ggccactgacaaccaccctta; TP53D3: ggcctcccctgcttgccaca; TP53R3: caaccacccttgtcctttct; TP53D4: ggcttctcctccacctacct; TP53R4: gcaggctaggctaagctatga; TP53D5: catgttgcttttgtaccgtca; TP53R5: cagctgcctttgaccatgaa.

Продукты ПЦР разделяли при помощи электрофо­реза в 6 % полиакриламидном геле (ПААГ) и визу­ализировали в УФ-свете после окрашивания броми­стым этидием. Для секвенирования ПЦР-продукты реакции очищали на колонках Wizard® SV Gel and PCR Clean-Up System Promega.

Праймеры синтезировали в ООО «Синтол». Секве- нирование проводили с помощью набора реактивов ABI PRISM®BigDyeTM Terminator v.3.1 с последую­щим анализом продуктов реакции на автоматическом секвенаторе ДНК ABI PRISM 3500 в ЦКП «Геном». Полученные с секвенатора электрофореграммы ана­лизировали в программе Vector NTI.

Результаты

Клиническое течение заболевания

Больной И. Ю. И., 1957 года рождения, наблюдал­ся в ФГБУ «НМИЦ гематологии» Минздрава России с мая 2013 г. с диагнозом ММ IIA ст. по Durie-Salmon, I ст. по ISS, I ст. по R-ISS. Диагноз был установлен в соответствии с критериями, разработанными Ме­ждународной рабочей группой по изучению ММ (The International Myeloma Working Group — IMWG) [35]. На момент диагностики заболевания был выполнен первый молекулярно-генетический скрининг (FISH, определение экспрессии и мутационный статус ге­нов). При проведении индукции ремиссии было вы­полнено пять курсов по программе PAD (бортезомиб + адриабластин + дексаметазон). После второго кур­са была достигнута частичная ремиссия (ЧР), а после пяти — очень хорошая частичная ремиссия (ОХЧР).

На фоне ОХЧР были выполнены мобилизация и сбор аутологичных стволовых клеток крови по схеме 4 г/м2 и гранулоцитарный колониестимулирующий фактор 5 мкг/кг. За две процедуры лейкафереза было заготов­лено 13,0 X 106/кг CD34+-клеток. В перерыве между сбо­ром аутологичных стволовых клеток крови и выполне­нием трансплантации аутологичных гемопоэтических стволовых клеток (ауто-ТГСК) с целью сдерживания достигнутого противоопухолевого ответа проведено четыре бортезомиб-содержащих курса (VCD: борте- зомиб + дексаметазон). По результатам обследования непосредственно перед ауто-ТГСК была констатирова­на полная строгая ремиссия заболевания (результаты иммунохимического исследования, данные костного мозга). Однако сохранялись остеодеструктивные очаги, замещенные содержимым жировой плотности. При об­следовании на +100-й день после ауто-ТГСК была кон­статирована прогрессия заболевания (В-симптомы, по данным иммунохимического исследования сыво­ротки крови и мочи помимо исходного парапротеина G-лямбда, впервые за весь период наблюдения была вы­явлена секреция парапротеина М-лямбда 5,3 г/л). Реин- дукционные бортезомиб-содержащие курсы оказались неэ фф ективными. Больной был переведен на вторую линию терапию иммуномодулирующими препаратами, на фоне которой удалось достичь лишь частичного про­тивоопухолевого ответа. Спустя четыре месяца от мо­мента констатации рецидива заболевания больной умер от тяжелых инфекционных осложнений.

Молекулярно-цитогенетическое исследование (FISH). При молекулярно-цитогенетическом ис­следовании (FISH) в дебюте заболевания был вы­явлен лишь гипердиплоидный тип ММ (трисомии 5, 9, 15) в 50 % ядер. При повторном цитогенетиче­ском исследовании на фоне прогрессии заболевания сохранялся гипердиплоидный тип ММ, однако по­явилась amp1q21 в 170 интерфазных ядрах из 200 исследованных, то есть в 85 % ядер. На рисунке 1 представлены результаты FISH-исследования мо- нонуклеаров костного мозга в дебюте заболевания, а на рисунке 2 — результаты FISH CD138+-клеток костного мозга в рецидиве ММ.

 

Рисунок 1. Результаты FISH-исследования мононуклеаров костного мозга в дебюте заболевания: А — гипердиплоидия (трисомии 5, 9, 15): три зеленых сигнала от локуса 5р 1 2, три голубых сигнала от локуса 9q22/NR4A3 и три красных сигнала от локуса 15q22/SMAD6; Б — амплификация локуса 1q21 не выявлена: два зеленых сигнала от локуса 1p32/CDKN2C и два красных сигнала от локуса 1q21/CKS1B

Figure 1. Results of FISH-analysis mononuclear cells bone marrow at diagnosis: А — hyperdiploidy (trisomies 5, 9, 15): three green signals of 5р12 locus, three blue signals of 9q22/NR4A3 locus и three red signals of 15q22/SMAD6 locus; Б — Amplification of locus 1q21 was not found: two green signals of 1p32/CDKN2C locus and two red signals of 1q21/CKS1B locus

 

 

Рисунок 2. Результаты FISH-исследования CD138+-клеток костного мозга в рецидиве заболевания: А — гипердиплоидия (трисомии 5, 9, 15): три зеленых сигнала от локуса 5р 1 2, три голубых сигнала от локуса 9q22/NR4A3 и три красных сигнала от локуса 15q22/SMAD6; Б — амплификация локуса 1q21: два зеленых сигнала от локуса 1p32/CDKN2C и четыре красных сигнала от локусс 1q21/CKS1B (два из них дополнительные)

Figure 2. Results of FISH-analysis CD138-positive cells bone marrow at the time of relapse: А — hyperdiploidy (trisomies 5, 9, 15): three green signals of 5р12 locus, three blue signals of 9q22/NR4A3 locus и three red signals of 15q22/SMAD6 locus; Б — Amplification of locus 1q21: two green signals of 1p32/CDKN2C locus and four red signals of 1q21/CKS1B locus (two of them are additional)

 

Анализ экспрессии генов с-MYC, MMSET, CCND1, CCND2, CKS1B, NOTCh3, IL-6, BCL2, TP53, MDM2. Анализ экспрессии гена с-MYC показал, что в реци­диве заболевания в плазматических клетках костного мозга больного незначительно повысилось количест­во мРНК с-MYC (в 1,5 раза по сравнению с моментом диагностики заболевания). Экспрессия с-MYC на мо­мент диагностики была в 4,4 раза выше, чем сред­нее значение, полученное в результате измерений для 10 доноров.

Значительноеувеличениеуровня экспрессии при раз­витии рецидива заболевания было выявлено для гена Notch3. Экспрессия Notch3 увеличилась в 3,2 раза, при­чем в дебюте заболевания она не превышала верхние показатели, полученные для доноров, но была выше усредненного значения. Наиболее заметное повыше­ние экспрессии наблюдалось для гена IL-6 в рециди­ве заболевания, его экспрессия увеличилась в 29 раз по сравнению с дебютом заболевания. Уже до нача­ла лечения значение экспрессии гена IL-6 было выше в три раза, чем среднее значение у доноров. Высокий уровень экспрессии гена MDM2 — репрессора р53 — был зарегистрирован в дебюте и при рецидиве заболе­вания, причем при рецидиве его количество возросло в 2,5 раза. Во время диагностики ММ его уровень был выше верхних показателей у доноров в два раза. Повы­шенное значение экспрессии в рецидиве по сравнению с дебютом заболевания можно также отметить у генов MMSET и CKS1B (в 3,5 и 1,8 раза соответственно). Зна­чительное снижение экспрессии во время прогрессии ММ было детектировано у генов CCND1 и CCND2. Од­нако ее значения находятся в диапазоне колебаний уровня экспрессии у доноров, и, вероятно, эти измене­ния не несут функциональной нагрузки. Экспрессия гена TP53 у больного не выходила за рамки значений, полученных для доноров (166 и 479 ngc соответствен­но) и существенно не изменилась в рецидиве по срав­нению с дебютом заболевания.

Отмечено снижение на порядок при рецидиве экс­прессии генов клональных иммуноглобулинов, характеризующих опухолевые клетки (IGHV3-33/IGHG2, IGLV1-44/IGLC2′), что соответствует выявленному при иммунохимическом исследовании уменьшению моноклональной секреции парапротеина G-лямбда с 23,8 до 5 ,4 г/л. В то же время экспрессия неклональ­ных иммуноглобулинов (в таблице 1 для примера при­ведены IGHV3-23 и IGHV2-5) снизилась почти на два порядка, что свидетельствует о наличии у больного с рецидивом заболевания глубокого иммунодефици­та. Полученные результаты анализа экспрессии генов представлены на рисунке 3 и в таблице 1.

 

Рисунок 3. Изменение экспрессии генов в дебюте ММ и при констатации рецидива у больного в сравнении со значениями экспрессии этих генов у доноров. По оси абсцисс расположены гены, по оси ординат — значения их экспрессии, выраженной в количестве прочтений гена, нормированное на общее число прочтений (normal­ized gene counts, ngc). Уровень экспрессии генов проанализирован в дебюте (синие окружности) и рецидиве (красные окружности) заболевания. Диапазон значений экспрессии данных генов у здоровых людей представлен в виде прямоугольников с перцентилями. Перцентили отображают разброс значений, где в верхнюю и в нижнюю перцентили попадает по 25 % краевых значений. Пересекающая прямоугольник линия — это медиана значений экспрессии для данного гена

Figure 3. Change in gene expression at the diagnosis of MM and at the time of relapse in comparison with the range expression of those genes in the group of donors. Axis X: genes, axis Y: gene expression values in normalized gene counts, ngc. Gene expression level (gene normalized counts) is analyzed at the diagnosis (blue circles) and at the time of relapse (red circles) of the patient with MM. Range of health people gene expression values are represented in the boxes with percentiles. The percentiles show the value below (lower percentiles) or above (upper percentiles) which 25 % of the observations may be found. The line which is crossing the box determines the median value of the expression of the gene

 

Мутационный статус генов N-RAS, K-RAS, BRAF и ТР53

Секвенирование экзонов 2, 3 и 4 генов N-RAS и K-RAS выявило у больного активирующую соматическую миссенс-мутацию с.182А> C в кодоне 61-го гена N-RAS (p.Q61P). В материале, взятом у больного во время рецидива, диагностированная ранее мутация в той же позиции сохранилась (рис. 4). Соотношение нор­мального и мутантного пиков на электрофореграмме, близкое к 1, свидетельствует о клональном характере данного нарушения.

 

Рисунок 4. Активирующая мутация гена N-RAS в кодоне 61. Фрагменты электрофореграмм 3-го экзона гена N-RAS, содержащие миссенс-мутацию (замена аденина на цитозин в 61-м кодоне): А — дебют заболевания; Б — рецидив заболевания

Figure 4. Activating mutation of N-RAS gene in 61st codon. Fragment of the sequence elecfrophoregram of N-RAS gene 3rd exon containing missence mutation (replacement of adenine by cytosine in 61 codon: A — disease debut; Б — disease relapse

 

При параллельном секвенировании ДНК и РНК гена N-RAS в клетках CD138+ опухоли в дебюте и рецидиве заболевания, электрофореграммы практически не отличались друг от друга (соотношение нормально­го и мутантного пиков 1:1), что свидетельствует об от­сутствии различий в экспрессии мутантного аллеля и аллеля «дикого типа».

Секвенирование экзона 15 гена BRAF, в котором обычно локализуются активирующие соматические мутации, в том числе наиболее распространенная p.V600E, показало отсутствие каких-либо отклонений от референсной последовательности как в первичном, так и в рецидивном материале.

Была проанализирована также первичная структу­ра всех функционально важных областей гена TP53 в материале опухоли как при диагностике ММ, так и при рецидиве заболевания. Соматических мутаций найдено не было. Выявлен только полиморфный вари­ант (p.P72R, rs1042522 в базе данных NCBI/SNP) в ге­терозиготном состоянии, не имеющий функциональ­ного значения [36].

Обсуждение

В работе был сопоставлен молекулярно-генети­ческий статус опухолевых клеток у больного ММ в дебюте и при рецидиве заболевания. Исходно про­тивоопухолевый ответ на индукционную терапию бортезомиб-содержащими курсами расценивался как полная иммунохимическая ремиссия, однако при рецидиве заболевания была констатирована рези­стентность к терапии бортезомибом. Рецидив заболе­вания сопровождался не только сохранением прежне­го клонального парапротеина IgG-λ, но и появлением не выявлявшегося ранее парапротеина IgM-λ. Имму- нохимический рецидив характеризовался появлением симптомокомплекса CRAB: включающего гиперкаль- циемию (Calcium), почечную недостаточность (Renal failure), анемию (Anemia) и остеолитическое пораже­ние костей (Bone lesions). Больной умер в результа­те инфекционных осложнений через четыре месяца от момента диагностики прогрессии заболевания.

При молекулярно-цитогенетическом исследовании в дебюте и при рецидиве заболевания была выявлена трисомия хромосом 5, 9 и 15. Гипердиплоидия при ММ ассоциируется с благоприятным прогнозом и лучшей выживаемостью больных [37].

На фоне прогрессии ММ у больного возникла но­вая цитогенетическая аберрация — амплификация локуса хромосомы 1 (amp1q21). Анализ экспрессии гена CKS1B, расположенного в этом локусе, показал ее возрастание при рецидиве примерно в два раза по сравнению с дебютом заболевания, что согласу­ется с увеличением его копийности. Данная хро­мосомная аномалия считается фактором плохого прогноза. Отчасти это может быть связано с увели­чением числа копий гена CKS1B и усилением его экспрессии, которое может влиять на общую и без- рецидивную выживаемость, а также резистентность к бортезомиб-содержащим курсам [38]. Показано [39] также, что amp1q21 значительно реже встречает­ся при МГНГ, чем при ММ, и может способствовать прогрессии заболевания, однако авторы этой работы пришли к выводу о том, что уровень экспрессии гена CKS1B на этот процесс не влияет, и он обусловлен, скорее всего, генетической нестабильностью длинно­го плеча хромосомы 1 как таковой.

Анализ транскриптомных данных  показал, что при рецидиве в сравнении с дебютом заболева­ния повышена экспрессия генов с-MYC, Notch3, MDM2 и IL-6. Однако, если экспрессия первых трех генов повысилась всего в 1,5—3 раза, количество транскрип­та гена IL-6 возросло почти в 30 раз. Не исключено, что именно резкое усиление экспрессии этого цитоки- на послужило пусковым механизмом прогрессии ММ у больного, поскольку IL-6 стимулирует клеточную пролиферацию, активируя различные сигнальные пути (MAPK, JAK-STAT, PI3K) [1, 40].

При рецидиве внутри каждого из этих путей наблю­далось повышение экспрессии по крайней мере одного гена регуляторного белка (RAF1, STAT4 и mTOR соот­ветственно). В свою очередь, индукция IL-6 может, по крайней мере отчасти, объясняться усилением экс­прессии гена Notch3 (в 3,3 раза по сравнению с дебю­том заболевания). Notch3 активирует экспрессию IL-6 в клетках костномозговых ниш (клетках стромы) и плазматических клетках костного мозга. Показано, что IL6 является одним из ключевых факторов, влия­ющих на жизнеспособность и неконтролируемое деле­ние миеломных клеток [30].

Экспрессия гена транскрипционного фактора с-MYC повысилась при рецидиве заболевания незначитель­но, всего в 1,5 раза, однако, как и в дебюте заболева­ния, была на существенно более высоком уровне, чем у доноров. Механизм повышенной экспрессии в дан­ном случае остается не ясен, так как при FISH-иссле­довании ни транслокации с вовлечением локуса гена с-MYC, ни трисомия 8 не были выявлены. Возможно, имеет место эпигенетическая регуляция гена с-MYC. Клетки, конститутивно экспрессирующие высокий уровень с-MYC, обладают пониженной зависимостью от ростовых факторов и большей скоростью пролифе­рации. Таким образом, повышенный уровень с-MYC также мог быть одним из факторов, спровоцировав­ших прогрессию ММ.

Экспрессия гена TP53 при рецидиве существенно не изменилась, оставаясь в пределах диапазона значе­ний экспрессии гена TP53 у доноров (табл. 1), и ника­ких мутаций в нем выявлено не было. При этом экс­прессия гена белка mdm2, являющегося ингибитором ТР53, увеличилась в 2,5 раза, что вполне могло повлечь за собой ослабление функции ТР53 при прогрессии за­болевания.

Резкое снижение экспрессии всех генов иммуногло­булинов, в том числе и клональных, соответствующих парапротеину G-лямбда, свидетельствовало о нали­чии глубокого иммунодефицита при прогрессии ММ.

В дебюте заболевания больной не относился к группе высокого риска по клиническим и цитогенетическим данным, однако у него была выявлена клональная ге­терозиготная мутация p.Q61P в гене N-RAS, благода­ря которой происходит неконтролируемая активация сигнального пути MAPK, ведущая к повышению про­лиферативного потенциала опухолевых клеток. После проведения курсов терапии при рецидиве заболевания мутация сохранилась в клональном состоянии. Вли­яние активирующих мутаций в генах семейства RAS на патогенез ММ исследуется давно и достаточно ак­тивно, однако результаты опубликованных работ при­водят к противоречивым выводам об их значимости. В исследовании, посвященном изучению дифференци­альной экспрессии мутантного и нормального аллелей [11], было показано, что мутантный аллель экспресси­руется слабее аллеля «дикого типа». У наблюдавшего­ся больного нормальная и мутантная копии гена N-RAS в дебюте и рецидиве ММ экспрессировались с оди­наковой эффективностью. Оба варианта белка могли играть существенную роль в активации сигнального МАРК-пути при прогрессии заболевания: мутантный белок — за счет потери контроля над ним со стороны цитокинов, нормальный белок — вследствие стимуля­ции гиперэкспрессией IL-6.

Таким образом, можно сделать вывод о том, что при ММ целесообразно выполнять комплексную молекулярную диагностику, включающую развернутое цитогенетиче­ское исследование, анализ экспрессии и мутационный анализ широкого спектра генов регуляторных белков, так как единичная хромосомная или генная аномалия вряд ли может сама по себе служить определяющим фактором прогноза развития заболевания и его рези­стентности к применяемой терапии.

1. Prideaux S.M., Conway O’Brien E., Chevassut T.J. The genetic architecture of multiple myeloma. Adv. Hematol. 2014; 864058. DOI: 10.1155/2014/864058

2. Fonseca R., Barlogie B., Bataille R. et al. Genetics and cytogenetics of multiple myeloma: A workshop report. Cancer Res. 2004; 64: 1546–58.

3. Maura F., Degasperi A., Nadeu F. et al. A practical guide for mutational signature analysis in hematological malignancies. Nat Commun. 2019; 10(1): 2969. DOI: 10.1038/s41467-019-11037-8

4. Bolli N., Biancon G., Moarii M. et al. Analysis of the genomic landscape of multiple myeloma highlights novel prognostic markers and disease subgroups. Leukemia. 2018; 32(12): 2604–16. DOI: 10.1038/s41375-018-0037-9

5. Bolli N., Avet-Loiseau H., Wedge D.C. et al. Heterogeneity of genomic evolution and mutational profi les in multiple myeloma. Nat Commun. 2014; 5: 2997. DOI: 10.1038/ncomms3997

6. Szalat R., Avet-Loiseau H., Munshi N.C. Gene Expression Profi les in Myeloma: Ready for the Real World? Clin Cancer Res. 2016; 22(22): 5434–42. DOI: 10.1158/1078-0432.CCR-16-0867

7. Chng W.J., Gonzalez-Paz N., Price-Troska T. et al. Clinical and biological signifi cance of RAS mutations in multiple myeloma. Leukemia. 2008; 22: 2280–4. DOI: 10.1038/leu.2008.142

8. Pylayeva-Gupta Y., Grabocka E., Bar-Sagi D. RAS oncogenes: weaving a tumorigenic web. Nat Rev Cancer. 2011; 11: 761–74.

9. Rasmussen T., Kuehl M., Lodahl M. et al. Possible roles for activating RAS mutations in the MGUS to MM transition and in the intramedullary to extramedullary transition in some plasma cell tumors. Blood. 2005; 105(1): 317–23.

10. Kim S.J., Shin H.T., Lee H.O. et al. Recurrent mutations of MAPK pathway genes in multiple myeloma but not in amyloid light-chain amyloidosis. Oncotarget. 2016; 7(42): 68350–9. DOI: 10.18632/oncotarget.12029

11. Rashid N.U., Sperling A.S., Bolli N. et al. Differential and limited expression of mutant alleles in multiple myeloma. Blood. 2014; 124: 3110–7.

12. Hu Y., Chen E., Wang J. Progress in the identifi cation of gene mutations involved in multiple myeloma. Onco Targets Ther. 2019; 12: 4075–80. DOI: 10.2147/OTT.S205922

13. Andrulis M., Lehners N., Capper D. et al. Targeting the BRAF V600E mutation in multiple myeloma. Cancer Discov. 2013; 3: 862–9. DOI: 10.1158/2159-8290. CD-13-0014

14. Levine A.J. p53, the Cellular Gatekeeper for Growth and Division. Cell. 1997; 88: 323–31.

15. Salmon S.E., Dalton W.S., Grogan T.M. et al. Multidrug-resistant myeloma: laboratory and clinical effects of verapamil as a chemosensitizer. Blood. 1991; 78: 44–50.

16. Brooks T.A., Hurley L.H. Targeting MYC Expression through G-Quadruplexes. Genes Cancer. 2010; 1(6): 641–9.

17. Dang C.V. MYC on the path to cancer. Cell. 2012; 149(1): 22–35. DOI: 10.1016/j.cell.2012.03.003

18. Gao P., Tchernyshyov I, Chang T.C. et al. c-myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. Nature. 2009; 458(7239): 762–5. DOI: 10.1038/nature07823

19. Kuzyk A., Mai S. c-MYC-induced genomic instability. Cold Spring Harb Perspect Med. 2014; 4(4): a014373. DOI: 10.1101/cshperspect.a014373

20. Karlsson A., Giuriato S., Tang F. et al. Genomically complex lymphomas undergo sustained tumor regression upon MYC inactivation unless they acquire novel chromosomal translocations. Blood. 2003; 101(7): 2797–803.

21. Mirabella F., Wu P., Wardell C.P. et al. MMSET is the key molecular target in t(4;14) myeloma. Blood Cancer J. 2013; 3(5): 114. DOI: 10.1038/bcj.2013.9

22. Chesi M., Bergsagel P.L. Molecular pathogenesis of multiple myeloma: basic and clinical updates. Int J Hematol. 2013; 97(3): 313–23. DOI: 10.1007/s12185-013-1291-2

23. Zhan F., Colla S., Wu X. et al. CKS1B, overexpressed in aggressive disease, regulates multiple myeloma growth and survival through SKP2- and p27Kip1- dependent and -independent mechanisms. Blood. 2007; 109(11): 4995–5001.

24. Smol T., Dufour A., Tricot S. et al. Combination of t(4;14), del(17p13), del(1p32) and 1q21 gain FISH probes identifi es clonal heterogeneity and enhances the detection of adverse cytogenetic profi les in 233 newly diagnosed multiple myeloma. Mol Cytogenet. 2017; 10: 26. DOI: 10.1186/s13039-017-0327-3

25. Lobry C., Oh P., Mansour M.R. et al. Notch signaling: switching an oncogene to a tumor suppressor. Blood. 2014; 123(16): 2451–9. DOI: 10.1182/blood-2013-08-355818

26. Colombo M., Mirandola L., Platonova N. et al. Notch-directed microenvironment reprogramming in myeloma: a single path to multiple outcomes. Leukemia. 2013; 27(5): 1009–18. DOI: 10.1038/leu.2013.6

27. Colombo M., Galletti S., Bulfamante G. et al. Multiple myeloma-derived Jagged ligands increases autocrine and paracrine interleukin-6expression in bone marrow niche. Oncotarget. 2016; 7(35): 56013–29. DOI: 10.18632/oncotarget.10820

28. Kishimoto T. The biology of interleukin-6. Blood 1989; 74: 1–10.

29. Frassanito M.A., Cusmai A., Iodice G., Dammacco F. Autocrine interleukin-6 production and highly malignant multiple myeloma: relation with resistance to drug-induced apoptosis. Blood. 2001; 97(2):483–9.

30. Gadó K., Domján G., Hegyesi H., Falus A. Role of interleukin-6 in the pathogenesis of multiple myeloma. Cell Biol Int. 2000; 24(4): 195–209.

31. Herrero A.B., Rojas E.A., Misiewicz-Krzeminska I. et al. Molecular Mechanisms of p53 Deregulation in Cancer: An Overview in Multiple Myeloma. Int J Mol Sci. 2016; 17(12): 2003. DOI:10.3390/ijms17122003

32. Simons A., Shaffer L.G., Hastings R.J. Cytogenetic Nomenclature: Changes in the ISCN 2013 Compared to the 2009 Edition. Cytogenet. Genome Res 2013; 141: 1–6. DOI: 10.1159/000353118

33. Dobin A., Davis C.A., Schlesinger F. et al. STAR: ultrafast universal RNA-seqaligner. Bioinformatics. 2013; 29(1): 15–21. DOI: 10.1093/bioinformatics/bts635

34. Love M.I., Huber W., Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014; 15(12): 550.

35. Rajkumar S.V., Dimopoulos M.A., Palumbo A. et al. International Myeloma Working Group updated criteria for the diagnosis of multiple myeloma. Lancet Oncol. 2014; 15(12): 538–48. DOI: 10.1016/S1470-2045(14)70442-5

36. Kodal J., Vedel-Krogh S., Kobylecki C. et al. TP53 Arg72Pro, mortality after cancer, and all-cause mortality in 105,200 individuals. Sci Rep. 2017; 7: 336. DOI: 10.1038/s41598-017-00427-x

37. Smadja N.V., Bastard C., Brigaudeau C. et al. Hypodiploidy is a major prognostic factor in multiple myeloma. Blood. 2001; 98(7): 2229–38.

38. Chen M.H., Qi C., Reece D., Chang H. Cyclin kinase subunit 1B nuclear expression predicts an adverse outcome for patients with relapsed/refractory multiple myeloma treated with bortezomib. Hum Pathol. 2012; 43(6): 858–64. DOI: 10.1016/j.humpath.2011.07.013

39. Stella F.,Pedrazzini E., Baialardo E. et al. Quantitative analysis of CKS1B mRNA expression and copy number gain in patients with plasma cell disorders. Blood Cells Mol Dis. 2014; 53(3): 110–7. DOI: 10.1016/j.bcmd.2014.05.006

40. Chauhan D., Uchiyama H., Akbarali Y. et al. Multiple myeloma cell adhesioninduced interleukin-6 expression in bone marrow stromal cells involves activation of NF-kappa B. Blood. 1996; 87(3): 1104–12.


Составлена самая подробная карта экспрессии генов в эмбрионе дрозофилы

Секвенирование РНК из тысяч индивидуальных клеток позволило германским биологам составить самую детальную на сегодняшний день карту экспрессии генов в эмбрионе дрозофилы на стадии начала гаструляции. Карта довольно точно отражает экспрессию 6–8 тысяч генов в каждой клетке эмбриона. Она позволяет решать разнообразные исследовательские задачи: обнаруживать неизвестные ранее регуляторы развития, анализировать общие закономерности трехмерной организации эмбриона и эволюции онтогенеза. Работа представляет собой важный шаг на пути к решению главной задачи биологии развития — полному и исчерпывающему пониманию того, как генотип воплощается в фенотипе.

Ключевую роль в эмбриональном развитии играет дифференцировка клеток, в основе которой лежит включение разных наборов генов в разных клетках в ответ на определенные сигналы (см. Как клетки понимают, что одни должны стать волосами, другие костями, третьи мозгами и т. п.?). Паттерны экспрессии генов — регуляторов развития создают пространственную разметку эмбриона, поэтапно рисуя на нем нечто вроде чертежа будущего организма (рис. 1).

Для дрозофилы Drosophila melanogaster, одного из самых изученных животных, уже известны пространственно-временные паттерны экспрессии десятков регуляторных генов. Это позволило в общих чертах разобраться в том, как формируются передний и задний концы тела, спинная и брюшная стороны, сегменты и органы (см. Михаил Никитин. Генные сети, управляющие строением тела животных). Но всё же картина остается неполной: изучены далеко не все гены, влияющие на развитие, а области их экспрессии картированы зачастую лишь приблизительно.

В идеале хотелось бы иметь точную информацию по экспрессии каждого гена в каждой клетке эмбриона на каждом этапе развития. Но возможно ли это? До сих пор такой уровень детализации был недостижим. Но наука не стоит на месте, и то, что казалось еще недавно недостижимой мечтой, вдруг становится реальностью.

В статье, опубликованной в журнале Science 13 октября, ученые из Центра Молекулярной Медицины Макса Дельбрюка (Max Delbrück Center for Molecular Medicine) в Берлине сообщили о создании самой детальной на сегодняшний день карты генной экспрессии эмбриона дрозофилы на этапе развития, предшествующем началу морфогенеза. В это время (так называемая стадия 6, см. Stage 6) эмбрион состоит примерно из 6000 клеток, еще не имеет видимых морфологических структур и только приступает к гаструляции.

Авторы сделали всё возможное, чтобы включить в анализ максимальное число генов (причем не только белок-кодирующих, но и генов регуляторных РНК), и чтобы добиться максимального пространственного разрешения, картировав экспрессию в каждой клетке эмбриона по отдельности. Для этого они воспользовались недавно изобретенной технологией Drop-Seq, основанной на помещении клеток в крошечные капельки воды, мечении РНК в каждой капле особой меткой и последующем тотальном секвенировании РНК (см. E. Z. Macosko et al., 2015. Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets). Метод Drop-Seq позволяет одновременно измерить в каждой клетке экспрессию нескольких тысяч генов. Индивидуальные метки дают возможность понять, какие из отсеквенированных молекул РНК происходят из одной и той же, а какие — из разных клеток.

Авторам удалось с высокой точностью измерить экспрессию генов примерно в 1300 клетках эмбрионов дрозофилы на стадии 6. Для каждой клетки уровень экспрессии был надежно определен в среднем для 3100 генов.

Предварительный анализ полученных данных показал, что профили экспрессии в разных клетках эмбриона различаются очень сильно: свой уникальный профиль имеет чуть ли не каждая клетка. Это значит, что составление карты экспрессии с максимальным, то есть клеточным уровнем разрешения — не блажь, а правильный и необходимый шаг на пути к пониманию механизмов развития.

К сожалению, метод Drop-Seq требует предварительного разделения эмбриона на отдельные клетки. При этом информация о том, из какой части эмбриона происходит та или иная клетка, теряется, и ее нужно потом как-то восстановить. В этом и состояла главная методологическая трудность, которую авторы должны были преодолеть. Для этого они использовали ту информацию по паттернам экспрессии отдельных генов, которая была получена ранее. В частности, в рамках проекта Berkeley Drosophila Transcription Network Project (BDTNP) была с большой точностью картирована экспрессия 84 генов — регуляторов развития (C. C. Fowlkes et al., 2008. A Quantitative Spatiotemporal Atlas of Gene Expression in the Drosophila Blastoderm). Проанализировав эти данные и сопоставив их с результатами Drop-Seq, авторы пришли к выводу, что, зная уровень экспрессии каждого из 84 генов в анализируемой клетке, можно довольно точно (с точностью до нескольких клеточных диаметров) определить, из какого места эмбриона происходит клетка.

Таким образом, каждая клетка была надежно «привязана» к определенному, очень небольшому участку эмбриона. Поскольку к каждому такому участку была привязана не одна, а несколько клеток, в каждой из которых был измерен уровень экспрессии в среднем 3100 генов (причем наборы генов с измеренной экспрессией были разными для разных клеток), то для каждого участка удалось в конечном счете оценить экспрессию 6–8 тысяч генов.

В результате получилась самая детальная на сегодняшний день трехмерная карта экспрессии генов в эмбрионе дрозофилы на стадии начала гаструляции. Карта представлена в виде интерактивной системы Drosophila Virtual Expression eXplorer (DVEX), которая для любого выбранного гена может показать паттерн экспрессии.

Авторы сравнивали изображения, нарисованные их программой, с реальными паттернами экспрессии отдельных генов, полученными классическим способом — при помощи гибридизации in situ. Сравнение показало, что карта получилась довольно точная (рис. 2).

Значение этой работы в том, что специалисты по биологии развития получили новый мощный инструмент для решения разнообразных научных задач. В заключительной части статьи авторы показали несколько возможных направлений, где их детище может найти применение.

Например, можно искать общие закономерности в разнообразии рисунков экспрессии различных генов. Это прольет свет на базовые принципы пространственной организации эмбриона. Авторы попытались классифицировать паттерны экспрессии изученных генов, построив для них дендрограмму сходства (рис. 3). Оказалось, что разнообразие рисунков экспрессии распадается на 10 кластеров, для каждого из которых можно составить обобщенный «архетипический» рисунок экспрессии. Подобные сведения важны для расшифровки регуляторных генных сетей: например, логично предположить, что гены, относящиеся к одному кластеру, имеют сходную систему регуляции, то есть похожим образом реагируют на те или иные сигналы.

Кроме того, подробная карта генной экспрессии может быть использована для обнаружения новых регуляторов развития. Один из примеров показан на рис. 2 справа внизу. Длинная некодирующая РНК CR43432, экспрессия которой ранее не картировалась и чья функция неизвестна, экспрессируется, как выяснилось, там и только там, где не экспрессируются важнейшие гены, контролирующие развитие нейроэктодермы, такие как SoxN. Это значит, что CR43432 с большой вероятностью является регулятором эмбрионального развития: возможно, она ограничивает распространение нейроэктодермы или влияет на развитие клеток, избравших не-нейроэктодермальную судьбу.

Имея точную карту экспрессии, можно проследить, в каких участках эмбриона производятся те или иные сигнальные вещества, и догадаться, для каких участков предназначены эти сигналы. Кроме того, карта поможет в изучении эволюции онтогенеза. Авторы проиллюстрировали эту возможность, построив для другого вида дрозофил, D. virilis, менее детальную карту экспрессии генов на той же стадии развития и обнаружив несколько контрастных отличий от D. melanogaster.

Работа представляет собой важный шаг на пути к решению главной задачи биологии развития, которая состоит в том, чтобы понять, каким образом наследственная информация воплощается в фенотипе. Причем понять не в общих чертах (для дрозофилы это уже, можно сказать, сделано), а во всех подробностях. Обладание полной информацией о том, как регулируется и на что влияет работа каждого гена в ходе онтогенеза, откроет перед человечеством небывалые возможности, вплоть до проектирования искусственных организмов с любыми желаемыми свойствами.

Источник: Nikos Karaiskos, Philipp Wahle, Jonathan Alles, Anastasiya Boltengagen, Salah Ayoub, Claudia Kipar, Christine Kocks, Nikolaus Rajewsky and Robert P. Zinzen. The Drosophila embryo at single-cell transcriptome resolution // Science. 2017. V. 358. P. 194–199. DOI: 10.1126/science.aan3235.

См. также:
1) Михаил Никитин. Генные сети, управляющие строением тела животных.
2) Шон Кэрролл. Бесконечное число самых прекрасных форм.
3) Как клетки понимают, что одни должны стать волосами, другие костями, третьи мозгами и т. п.?

Александр Марков

Вечный джентльмен: как Колин Ферт заставляет сопереживать, оставаясь невозмутимым

10 сентября Колин Ферт отмечает 60-летие. На экране он практически всегда олицетворяет статное достоинство и безупречные манеры, подобающие английскому аристократу. Долгое время общественность видела в нем в первую очередь элегантного героя-любовника, хотя его диапазон предполагал намного большее. Несмотря на почтенный возраст, Ферт до сих пор органичен в романтическом амплуа — просто теперь ни у кого нет сомнений, что в серьезных ролях и даже в очумелых боевиках он не менее изыскан.

Колин Ферт

© Alessandra Benedetti — Corbis/Corbis via Getty Images

Даже к славе он шел плавно и без унизительной суеты. Строго говоря, не больно-то он ее и хотел — и отчасти даже побаивался. Конечно, признание публики было ему приятно. С другой стороны, церемонно выбрасывать из кустов под домом шебуршащих папарацци не доставляло ему такого же удовольствия. Ферт хотел бы, чтобы его воспринимали как футбольную команду второго дивизиона, за которую болеют от сердца, но без массовой истерии. Долгое время ему удавалось поддерживать этот деликатный баланс и жить нормальной жизнью. Однако десять лет назад он «опрометчиво» сыграл монарха в биографической драме «Король говорит!», получил «Оскара» и попрощался с покоем, став суперзвездой.

Узник мокрой рубашки

До 50 лет Ферту нередко приходилось бороться с заезженным восприятием себя в глазах зрителей и киноиндустрии. В 1989 году он сыграл главную роль в исторической драме «Вальмон», однако все лавры достались вышедшим годом ранее «Опасным связям» — другой экранизации того же самого романа Шодерло де Лакло. Первой поворотной точкой в фильмографии Колина стал мини-сериал «Гордость и предубеждение» (1995).

Актер терзался сомнениями, стоит ли ему браться за столь неприятного персонажа, как мистер Дарси, — разве может такой тип хоть кому-то понравиться? На тот момент наивный Ферт еще не читал Джейн Остин и даже не подозревал, что именно о подобном типаже и мечтают многие женщины. В итоге он рассудил, что хотя бы хорошо развлечется и насладится свободой, примеряя на себя образ столь надменного героя. Все пошло не по плану — у девушек всего мира появился новый кумир.

Особенно роковой оказалась сцена, которой даже не было в книге. Образ выходящего из озера Ферта во влажной рубашке навсегда отпечатался в коллективном бессознательном представительниц прекрасного пола. В 2013 году в Лайм-парке в Англии даже установили статую из стеклопластика высотой 3,5 метра, которая увековечила мокрого Колина. Долгое время эта роль не выпускала Ферта из своей тени, перекрывая все его достижения.

Статуя мистера Дарси в Лайм-парке

© Lynne Cameron/PA Wire

С тех пор актер предусмотрительно бежал от Джейн Остин как от огня и старался уклоняться от схожих предложений. Однако, несмотря на все усилия, он стал постоянным гостем в исторических мелодрамах («Английский пациент», «Влюбленный Шекспир», «Как важно быть серьезным») и в романтических комедиях («Дневник Бриджит Джонс», «Реальная любовь»), где требовалась его мужская импозантность. К слову, «Дневник Бриджит Джонс» тоже был своего рода подмигиванием его сложившемуся к тому времени амплуа — книга-первоисточник просто перекладывала сюжет «Гордости и предубеждения» на современный лад. Даже его героя вновь звали Дарси. Как и в прошлый раз, его популярность вновь подскочила.

Однако за пределами амурных картин потенциал актера оставался нераскрыт. У него складывалась хорошая карьера, но от сковывающих стереотипов она избавилась лишь десять лет назад.

Когда устал заниматься любовью, а не войной

На эту тему

Вырваться из плена ромкомов Ферту помогли две знаковые роли: в «Одиноком мужчине» (2009) и в «Король говорит!» (2010). В первом случае он сыграл профессора-гомосексуалиста, который узнает о смерти своего партнера и должен за день привести в порядок дела, прежде чем покончить с собой. Во втором он предстал в качестве короля Георга VI, страдающего от заикания. Обе партии принесли ему номинации на «Оскар» за лучшую мужскую роль, а образ монарха с дефектами речи — еще и победу в этой категории.

Ферт всегда сторонился крупных студийных проектов, хотя иногда и затесывался в помпезные зрительные постановки вроде мюзикла Mamma MIA!, где он пел без особого энтузиазма. Однако режиссеру Мэттью Вону, брату по разуму Гая Ричи, удалось вывести утонченного актера из зоны комфорта. Он уговорил Колина засветиться в шпионском блокбастере по комиксам «Kingsman: Секретная служба» (2015) и стать звездой боевика. Аргументация была простая: постановщик звал Ферта не потому, что он лучше всех подходил на роль, а потому, что он последний человек на свете, от которого ожидают подобного.

В результате заслуженный герой-любовник превратился на экране в настоящую машину смерти, при виде которой даже Джеймс Бонд нервно поперхнется мартини. Потасовка, где джентльмен Колин устраивает рукопашный геноцид в церкви, смело претендует на звание лучшей экшен-сцены в истории. Шесть месяцев тренировок окупились сполна, хотя поначалу изнеженный слащавыми ромкомами актер чуть ли не падал в обморок после пары приседаний.

На премьере фильма «Kingsman: Секретная служба» в Лондоне, 2015 год

© Dave J Hogan/Getty Images

С тех пор Ферт свободен ото всех цепей и волен выражать себя во всех жанрах, как ему заблагорассудится.

Самурайское хладнокровие перед камерой

Колин не из тех исполнителей, что будут неистово рвать на себе волосы, размахивать руками и брызгать слюной, выворачивая себя наизнанку. Для него характерна сдержанная и минималистичная манера, которая передает состояния персонажа через более тонкие нюансы.

Ярче всего это проявилось в «Одиноком мужчине». Ферт колебался, соглашаться ли ему на участие в проекте режиссера-дебютанта Тома Форда, известного в мире моды кутюрье. Определиться актеру помогла его любимая цитата, которую он приписывает джазовому трубачу Майлзу Дэвису: «Не играйте, что вы знаете, — играйте, что не знаете». Колин изобразил боль утраты без избыточной мелодрамы, удерживая зрительское внимание в течение 101 минуты своими внутренними переживаниями.

По сути, отсутствие экспрессии у героя становилось его щитом от непоправимой реальности. Привычка безупречно одеваться тоже являлась частью этой брони, создавая иллюзию нормальности и порядка. Том Форд верил в выразительные способности спокойной и стоической мимики. Он не грузил свою звезду инструкциями и установками, в результате чего Ферт получил редкую для актера свободу.

Актриса Энн Хэтэуэй и президент Академии кинематографических искусств и наук Том Шерак объявляют номинантов на лучшую мужскую роль во время 82-ой премии Оскар в Голливуде, 2010 год

© REUTERS/Danny Moloshok

Правильный выбор гардероба играет важную роль в раскрытии образа, и в «Одиноком мужчине» большие очки героя фокусировали на себе внимание и правдоподобно передавали его тревогу. Что уж говорить про мокрую рубашку из «Гордости и предубеждения», которая дала Колину дорогу в жизнь. Можно сказать, он вышел из нее практически как русские писатели из гоголевской «Шинели».

Ферт вдумчиво подходит к своим партиям и готовится к ним на грани зубрежки. Актер столь усердно изучал творчество Яна Вермеера, которого он играл в «Девушке с жемчужной сережкой» (2003), что Скарлетт Йоханссон пошутила: «Колин, наверное, думает, что сам нарисовал все эти картины».

Ферт считает, что задача лицедея — повышать ставки для персонажа и создавать для него сложности, пропуская через себя постыдные эмоции вроде злости, стыда, слабости и паранойи. Конечно, он не может взять проблемы из ниоткуда, если их нет в сценарии. Тем не менее одна и та же сцена допускает совершенно разные обыгрывания. Например, его мистер Дарси практически ничего не делал в кадре, но Ферт не показывал его пофигистом. Вместо этого он заставлял героя сражаться с внутренними противоречивыми импульсами. В каких-то сценах он хотел уйти, но не мог; ругался с Элизабет Беннет, но при этом вожделел ее. Через разжигание внутренней борьбы в персонаже в кадре нарастало напряжение.

На эту тему

В школе драмы Колина учили никогда не играть эмоции. Их можно искать внутри себя и испытывать, но в кадре надо реагировать на действия, а не изображать чувства. Для Ферта важнее добраться до правды переживания, нежели идеально что-то сымитировать. Даже играя историческую фигуру, как в фильме «Король говорит!», он подходил к работе креативно. Как следствие, актер не стремился звучать как Георг VI, но пытался прочувствовать его тревоги.

Обычно лицедеям приходится оттачивать акценты и речь до совершенства. «Король говорит!» поставил перед Фертом прямо противоположную нетривиальную задачу: разучиться разборчиво говорить и начать правдоподобно запинаться. Колин не просто играл заминки — его персонаж изо всех сил старался их избегать и спешил к концу предложения. Заикание годами использовалось в комедиях как повод для шуточек, но в действительности люди, неспособные внятно изъясняться, живут под большим психологическим давлением.

Роль не далась Ферту легко. От перевоплощения в заикающегося человека, который пытается этого не делать, актера мучили головные боли и даже немела левая рука. Привычка запинаться просочилась со съемочной площадки в реальную жизнь — правда с завершением работы над фильмом состояние Колина пришло в норму.

Кстати, изначально партия Георга VI писалась под Пола Беттани, но тот на свое горе отказался. Ферт удачно вышел со скамейки запасных и урвал все возможные награды.

Несмотря на приближение к пенсионному возрасту, кажется, что в карьере Колина самое интересное только начинается.

Что смотреть с Колином Фертом

«Гордость и предубеждение» (мини-сериал, 1995)

«Одинокий мужчина» (2009)

«Король говорит!» (2010)

«Kingsman: Секретная служба» (2015)

Захочешь стать «вторым Достоевским», будешь десятым — Российская газета

«РГ» продолжает цикл интервью с финалистами премии «Большая книга». Ольга Славникова, писательница и координатор премии «Дебют», автор романа «2017» и лауреат «Русского Букера», попала в шорт-лист «Большой книги» с романом «Легкая голова».

Российская газета: Это ваш первый «московский роман». Москва в нем — полноправная героиня, или городское пространство лишь сюжетный фон?

Ольга Славникова: Конечно, полноправная героиня: без Москвы не было бы этого романа. Мне понадобилось больше пяти лет жизни в Москве, чтобы напитаться столицей, почувствовать то, что я ощущала у себя на Урале: присутствие тайны. Москва в романе — живой организм, и более того: разумное существо. У Москвы есть и болезни, и страхи, и подавленные воспоминания, но есть и огромная энергетика, меняющая человека, который приехал сюда жить.

РГ: Существуют ли серьезные различия между провинциальной и столичной прозой?

Славникова: В столицах автор, если он не обладает большой природной силой таланта и характера, ориентируется на тренд. Ну, и на «свой круг»: знает, кому персонально хочет понравиться. В провинции писатель одинок и говорит с великими, что стоят у него на книжной полке. Его тексты часто кажутся наивными, столичная критика не находит у него тех элементов, что опознаются как «продвинутость». Зато в удаче и неудаче такой автор сосредоточен на сути. Впрочем, Интернет стирает различия: сегодня модный автор может проявиться и на Урале, и на Камчатке.

РГ: Кого из писателей, не живущих в Москве, вы особенно выделяете?

Славникова: Захара Прилепина и Алексея Иванова. Они разные, общее одно: подлинность. Оба неровные: есть вершины, есть спады. Но ровной бывает посредственность, всегда знающая, как надо писать. А талант — не знает, потому рискует. Есть еще молодые: Игорь Савельев из Уфы, Павел Костин из Калининграда, Андрей Кузечкин из Нижнего Новгорода.

РГ: Какой типаж может стать новым героем для литературы?

Славникова: Тот, кого раньше назвали бы «идейным». Мы живем во времена победившего цинизма, когда деньги, конвертируемые во власть, стали мерой вещей. Нам якобы открылась эта истина. Находкой для литературы станет персонаж, который сделает обратное открытие. Необязательно это будет положительный герой. Он может стать экстремистом, может совершить что-то ужасное только для того, чтобы быть услышанным. Важен переворот в сознании — за который герою, конечно, придется заплатить.

РГ: Каков средний возраст современного писателя? Не кажется ли вам, что он выше среднего?

Славникова: Писательство — биологическая программа, поэтому средний возраст литератора тот же, что у всех: лет около сорока. Но давайте различать писателя и известного писателя. Чтобы набрать известность, литератору в нормальных условиях нужно лет десять. А у нас, поскольку произошел перелом и низведение культуры в разряд развлечений, это время неопределенно возросло. Сейчас работают старые бренды: массы знают тех, кто был уже известен до перестройки. Андрея Битова, например, или Евгения Евтушенко. Поэтому кажется, что большинство писателей — люди «золотого» возраста.

Мы живем во времена победившего цинизма, когда деньги стали мерой вещей

РГ: Просматривается ли некая тенденция в произведениях молодых авторов, присылающих свои тексты на «Дебют»?

Славникова: В этом году появилось много исторической прозы. Не этнотриллеров, не «альтернативной истории», но именно добротных реалистических реконструкций, с живыми характерами, с бытом, с прописанным фоном. Эта ниша у нас долго пустовала. Другая тенденция — повествование на основе реальных событий. Мы обозначили этот тип письма как «прозу-свидетельство». Автор побывал в «горячей точке», в научной экспедиции, прошел через национальный конфликт. Ему важен не столько художественный результат, сколько фиксация опыта. Если говорить о стилистических перекличках — заметно влияние блогосферы. Небрежность, языковой субъективизм, почти устная речь — но и какая-то внезапная экспрессия в этой непричесанности. Посмотрим, как молодая литература будет осваивать этот, по сути, уличный язык.

РГ: В чем, по-вашему, основное назначение литературных премий?

Славникова: Литература нуждается в иерархиях. Здесь нет равенства по той простой причине, что у всех разный масштаб таланта. Если представить себе идеал премиального процесса — то есть без лоббирования, без выполнения членами жюри дружеских обязательств, без подгонки голосования под нужный результат — то литературная премия существует для обозначения будущей классики. Это важно именно для внутреннего развития литературы. Здесь принцип «ни одна блоха не плоха» ведет к деградации. Как ни странно, в целом литературные премии свою задачу выполняют. Конечно, не каждый год рождается что-то выдающееся. Но каждая премия имеет свой топ-лист. Привлечение массового внимания к литературе — уже вторая задача, но тоже существенная. Что еще может служить рекомендательным списком для читателя, как не премиальные шорт-листы? Уж точно лучше, чем приоритетные выкладки в книжных магазинах.

РГ: Существует ли некий писательский секрет успеха?

Славникова: Каждый год финалисты «Дебюта», собираясь в Москве, пытаются вызнать у старших товарищей этот самый Top Secret. Тогда возникает встречный вопрос: ребята, а какого именно успеха вы хотите? Если тиражей и денег, тогда формула несложная: соблюдение схемы жанра, плюс актуальный материал, плюс бюджет на раскрутку. Если хотите стать модным, тогда рубите фишку и при этом будьте проще: читатель к вам потянется. А если хотите своего, предназначенного только вам успеха, тогда не желайте успеха, просто пишите, как если бы в стол. По моему мнению, в идеале шорт-лист крупной премии должен состоять из текстов, авторы которых про эту премию начисто забыли. Но идеал, конечно, недостижим, и призраки премиальных лавров витают над писательскими головами, как стая ворон. Нет рецепта. Просто надо писать о том, что тебя действительно волнует. И не пытаться повторить успех, свой или чужой. Захочешь стать «вторым Кафкой» или «вторым Достоевским» — будешь, в лучшем случае, десятым. Но особенно опасно стать «десятым собой».

Тогда говорят: исписался. А литератор всего лишь побоялся нового в себе.

Подавление экспрессии генов — это… Что такое Подавление экспрессии генов?

Подавление экспрессии генов (сайленсинг генов от англ. gene silencing, или в частности, выключение гена) — это общий термин, описывающий эпигенетический процесс регуляции генов. При этом последовательность нуклеотидов не изменяется, а лишь прекращается экспрессия соответствующего гена. Для выключения генов в лабораторных условиях применяют метод нокдауна генов.

Сайленсинг генов может происходить как на уровне транскрипции, так и на посттранскрипционном уровне.

Сайленсинг генов на уровне транскрипции является результатом модификации гистонов, в гетерохроматине, которая приводит к тому, что соответствующие участки ДНК становятся недоступными для аппарата транскрипции (РНК-полимераза) и факторов транскрипции.

Сайленсинг генов на посттранскрипционном уровне является результатом разрушения (деградации) мРНК соответствующих генов. Разрушение мРНК препятствует трансляции и формированию продукта гена (обычно, полипептида, белка). Общий механизм посттранскрипционного сайленсинга генов это путь РНК-интерференции (RNAi).

Оба пути выключения генов используются для регуляции собственных генов. Механизмы сайленсинга генов также защищают организм от транспозонов и вирусов. Поэтому механизмы сайленсинга генов могут быть частью эволюционно древней иммунной системы, защищающей от чужеродной ДНК.

В процессе мейоза гены могут выключаться путем метилирования ДНК, например, у Neurospora crassa.

Частные случаи

Некоторые другие термины относятся к частным случаям выключения генов

Сайленсинг на уровне транскрипции

Сайленсинг на посттранскрипционном уровне

Выключение генов в мейозе

Клеточные компоненты аппарата выключения генов

Существует два подхода супрессии генов на посттранскрипционном уровне — технология с использованием рибозимов и antisense-технология (антисмысловые РНК) .

Внешние ссылки

Почему быть лысым — не так уж плохо

  • Зарайя Горветт
  • BBC Future

Автор фото, Getty Images

Хотите казаться более умным, более влиятельным, образованным и честным человеком? Обозреватель BBC Future утверждает, что для этого нужно всего лишь обзавестись лысиной.

Чтобы бороться с облысением, викинги использовали примочки из гусиного помета. Древнегреческий медик Гиппократ лучшим лекарством от облысения считал голубиный помет, который он смешивал с хреном, тмином и крапивой.

Согласно одному египетскому рецепту 5000-летней давности, нужно было сжечь колючки ежа, смешать их с маслом, добавить в эту массу мед, алебастр, красную охру и, наконец, немного обрезков ногтей. Получившимся снадобьем следовало обильно смазывать облысевшие области.

Вопрос облысения волнует мужчин с тех самых пор, как в обиход вошли зеркала. Юлий Цезарь, к примеру, был просто одержим мыслями о том, как вернуть свою шевелюру, и был готов на все ради этого.

Лавровый венок он носил не столько для того, чтобы отдать дань римским традициям, сколько ради маскировки проплешин.

К моменту знакомства с Клеопатрой он был почти полностью лысым. Возлюбленная всеми силами пыталась помочь Цезарю сохранить шевелюру и предложила ему домашнее средство на основе измельченных тушек мышей, лошадиных зубов и медвежьего жира.

К сожалению, это снадобье также оказалось бессильным, и Цезарь потерял свои волосы, как и многие мужчины до и после него, в том числе Сократ, Наполеон, Аристотель, Ганди, Дарвин, Черчилль, Шекспир и Гиппократ.

Последний, несмотря на активное применение голубиного помета, был настолько лыс, что его именем даже назвали тип облысения.

В конце концов Цезарь смирился со своей участью и начал отращивать волосы сзади и зачесывать их вперед, чтобы создать хотя бы иллюзию наличия естественной растительности на голове. Эта прическа под названием «зачес» популярна до сих пор.

Автор фото, Wikimedia Commons

Подпись к фото,

Лысых мужчин часто считают умными, имеющими высокий статус и влиятельными, и Чарльз Дарвин прекрасно соответствует этому образу

Прошли тысячи лет, и мы сменили венки и отвратительные снадобья на дорогие кремы, тоники и шампуни, а в особо тяжелых случаях — на парики, лекарства и операции по пересадке волос.

Современный мужчина может посетить специализированную клинику или записаться на прием к специалисту по лечению облысения. Часто можно встретить рекламные объявления, в которых лысеющим мужчинам советуют «сходить к врачу».

В газетных статьях облысение называют эпидемией, в то время как сам феномен получил новое, по-научному звучащее название: «андрогенная алопеция». Тот, кто никогда его не слышал, может подумать, что это болезнь.

Поэтому неудивительно, что люди по всему миру ежегодно тратят на лечение облысения 3,5 млрд долларов США.

Эта сумма больше годового национального бюджета Македонии и, как верно отметил в прошлом году Билл Гейтс, значительно больше суммы, направляемой на борьбу с малярией (всего 200 млн долларов в год).

Современные лекарства уже не содержат столь сомнительных компонентов, как в далеком прошлом, однако последствия их приема могут быть пугающими.

Объем продаж препарата для лечения облысения под названием «Пропеция», прием которого ученые связали с импотенцией, в 2014 году достиг рекордного значения в 264 млн долларов.

Операция по пересадке волос, в свою очередь, очень травматична и болезненна — известно, что во время нее многие мужчины не могут сдержать слез.

Согласно опросу, проведенному Международным обществом хирургии восстановления волос в 2009 году, почти 60% мужчин предпочтут роскошную шевелюру деньгам и друзьям.

Не зря ли они идут на подобные жертвы?

Автор фото, Getty Images

Подпись к фото,

Сэр Патрик Стюарт потерял волосы уже в 19 лет

Появляется все больше доказательств того, что лысина — это не просто неудачная шутка эволюции. Лысых мужчин считают более умными, властными и имеющими более высокий статус, а их гладкий череп может стать средством соблазнения женщин или даже спасения жизни.

Прежде чем перейти к преимуществам, которые дает лысина, стоит развенчать широко распространенные мифы.

Вопреки популярному мнению и существованию таких брутальных лысых мужчин как Брюс Уиллис, склонность к потере волос никак не связана с большей мужественностью и более высоким уровнем тестостерона.

Тем не менее у лысых мужчин, как правило, больше волос на руках, ногах и груди. И, как ни странно, у них на голове бывает ничуть не меньше волос, чем у всех остальных.

Так как же это происходит?

Несмотря на то, что проблема облысения во все времена привлекала к себе огромное внимание, мы долго не могли понять истинные причины этого явления.

Аристотель полагал, что мужчины лысеют из-за половых сношений, а эпидемию облысения среди древнеримских солдат объясняли ношением тяжелых железных шлемов.

Позже появились теории о том, что во всем виновато «усыхание мозга» — считалось, что человек лысеет из-за того, что его мозг уменьшается в размерах и отдаляется от стенок черепа.

Кроме того, среди возможных причин облысения называли загрязнение воздуха и, как ни парадоксально, неправильную стрижку.

В 1897 году французский дерматолог заявил, что истинные виновники облысения — микробы.

Мир охватила паника. Парикмахеры и ученые призывали немедленно принять меры — регулярно кипятить расчески и ни в коем случае не пользоваться расческами людей, страдающих от облысения.

Сегодня нам доподлинно известно, что облысение вызывает дигидротестостерон (ДГТ) — биологически активная форма тестостерона. Этот гормон еще в утробе матери играет важную роль в развитии мужских половых органов.

У взрослых мужчин, чувствительных к ДГТ, волосяные фолликулы под его действием сокращаются. В результате этого обычные, полностью сформировавшиеся волосы превращаются в короткие и мягкие волоски, похожие на пушок на голове младенца.

Учитывая то, что ДГТ — это одна из форм тестостерона, можно предположить, что при высоком уровне тестостерона вырабатывается больше ДГТ, и человек теряет больше волос.

Однако на самом деле для начала потери волос достаточно лишь небольшого количества этого гормона.

Склонных к облысению мужчин отличает чувствительность волосяных фолликулов, наследуемая по материнской линии.

Очень важен тот факт, что эта особенность передается по наследству. К 30 годам, то есть задолго до окончания репродуктивного периода жизни, у 25-30% мужчин уже в той или иной степени наблюдается потеря волос.

Более того, это происходит с мужчинами во всех странах мира, во всех без исключения этнических группах.

Если бы быть лысым было так плохо, это явление исчезло бы со временем. Тот факт, что оно настолько широко распространено, может даже говорить о его полезности, но в чем она заключается? И если это так, почему облысением страдают только мужчины?

«В природе есть такая закономерность: если у мужчины есть что-то, чего нет у женщины, это что-то будет служить в качестве сигнала», — говорит Фрэнк Мускарелла, психолог из Университета Барри. Эта тема заинтересовала его еще в 1990-х годах.

Большинство этих особенностей, характерных только для представителей мужского пола, имеют схожее предназначение.

«Как правило, они показывают, что этот самец склонен доминировать и имеет большие репродуктивные возможности», — говорит Мускарелла.

Другими словами, лысина может быть эквивалентом яркого и пышного павлиньего хвоста и выполнять схожие функции — привлекать представительниц женского пола.

Автор фото, Getty Images

Подпись к фото,

Во время Второй мировой войны сэр Уинстон Черчилль проявил себя как мужественный и волевой человек

Более ранние исследования показывали, что женщины не находят лысых мужчин привлекательными — скорее всего, потому что редеющая шевелюра ассоциируется с преклонным возрастом, а старость вряд ли может считаться синонимом красоты.

«Нам известно, что женщинам нравятся мужчины с высоким социальным статусом. В лысине заключается не физическая, а несколько иная привлекательность», — говорит Мускарелла.

Чтобы развеять сомнения, уточним, что ученый не имеет личной заинтересованности в этой теории. «Нет, я не лысый, у меня довольно густая шевелюра», — говорит он.

В 2004 году он решил провести исследование в интересах тех, кому повезло меньше. Чтобы исключить факторы, которые могли бы исказить результаты, Мускарелле пришлось собственноручно создавать образы лысых мужчин.

Мускарелла привлек к участию в эксперименте своего друга-парикмахера, и они отправились в местный магазин париков.

«Я попросил его постричь волосы на париках так, чтобы один из них казался густым, другой — лысеющим, а третий — совершенно лысым», — говорит он.

Как правило, у мужчин, лысеющих естественным путем, остается немного волос над ушами и на затылке, поэтому парик понадобился даже для лысого образа.

После того, как друг Мускареллы закончил работу над париками, последний купил три пластиковых шапочки и прикрепил к ним парики при помощи липучки.

Затем они попросили шестерых студентов примерить парики и сфотографировали их. «Само собой, они выглядели просто ужасно», — говорит он.

К счастью, его соавтор совсем недавно приобрел совершенно примитивную программу для редактирования фотографий. Пиксель за пикселем они стирали бросающуюся в глаза линию между краем шапочки и лбом, пока снимки не стали относительно нормальными.

Затем они использовали эти снимки в своем эксперименте. Мускарелла показал их 202 студентам-психологам, среди которых было поровну мужчин и женщин, и попросил их оценить привлекательность мужчин и аспекты их личности.

Лысые и лысеющие мужчины не показались участниками столь же привлекательными, как другие, но в одной категории характеристик намного опередили остальных.

Их посчитали более умными, влиятельными, компетентными, образованными, честными, отзывчивыми, а также обладающими более высоким социальным статусом. Все эти черты в совокупности известны как социальная зрелость.

Мускарелла предположил, что облысение развилось как сигнал высокого социального статуса — того, перед чем не могут устоять некоторые женщины.

Любопытно, что лысых мужчин также считали значительно менее агрессивными.

«Если задуматься об этом, то можно представить себе, что на самой заре человечества древние люди разгуливали голышом, все их тело было покрыто густой растительностью, и те, у кого ее было больше — например, обладатели пышной шапки волос или густой бороды — имели довольно устрашающий вид», — говорит Мускарелла.

Таким образом, облысение могло служить для того, чтобы отличить взрослых, обладающих высоким статусом мужчин от агрессивных юношей.

Автор фото, Evan Agostini

Подпись к фото,

Хотя Салман Рушди больше известен своим писательским талантом, чем внешностью, в 2004 году он женился на модели Падме Лакшми

Если всё это так, то люди уже давно поняли, как этот сигнал можно использовать в собственных целях.

Мускарелла отмечает, что традиция брить голову еще несколько веков назад укоренилась среди философов, проповедников и священников.

Католические монахи пошли еще дальше — они не бреют голову целиком, а выбривают волосы так, чтобы казалось, что они потеряли волосы естественным образом (речь идет о тонзуре — выстриженном или выбритом месте на голове — Ред.).

Эти выводы подтверждаются результатами многих других исследований.

Большинство людей из разных уголков мира, от работников плантаций сахарного тростника в Бразилии до учеников старшей школы из Замбии, считают лысеющих мужчин более властными, независимо от того, потеряли ли они волосы естественным путем или просто сбрили их.

Результаты другого исследования звучат еще более заманчиво, хоть и являются спорными. Ученые пришли к выводу, что облысение может спасти человеку жизнь.

Долгое время верным считалось обратное. Достаточно давно было известно, что мужчины, у которых не вырабатывается ДГТ, например, подвергшиеся кастрации, на протяжении всей жизни имеют густые длинные локоны.

Любопытно то, что у представителей этой группы ни разу не было зарегистрировано случаев рака простаты.

ДГТ отвечает за развитие простаты у младенцев, поэтому логично было бы предположить, что в зрелом возрасте этот гормон будет влиять на образование опухолей.

И рак простаты, и облысение могут быть вызваны гормональной чувствительностью, передающейся по наследству. Это подтвердило исследование, проведенное в этом году.

Автор фото, Getty Images

Подпись к фото,

В прошлом году Ллойд Бланкфайн, владелец инвестиционного банка Goldman Sachs, занял 26-е место в списке наиболее влиятельных людей мира по версии Forbes

Ученые обнаружили, что у лысеющих мужчин выше вероятность развития агрессивного рака простаты, от которого ежегодно умирает около 300 000 человек.

Звучит не очень оптимистично, но здесь есть один нюанс. Низкий уровень витамина D, вырабатываемого организмом только при нахождении на солнце, также является известным фактором риска рака простаты.

Любой лысый человек скажет вам, что солнечный свет воздействует на него намного сильнее, чем на всех остальных. Развилась ли склонность к облысению как способ противостояния пагубному влиянию ДГТ?

«Тысячи лет назад это, возможно, помогало европейцам получать большую дозу солнечного облучения и вырабатывать больше витамина D», — говорит Питер Кабаи из Университета святого Иштвана, Венгрия, которого эта идея посетила после того, как он сам начал лысеть.

Это также может объяснить, почему не лысеют женщины, ведь у них нет простаты.

Доказательств у этой теории становится все больше. Мужчины, работающие на свежем воздухе, менее подвержены этому заболеванию по сравнению с теми, кто проводит больше времени в закрытом помещении.

Это относится и к тем, кто имеет загар, любил загорать в детстве, живет в теплом климате или чаще проводит отпуск за границей на морских курортах.

Влияние солнечного света столь высоко, что значение имеет даже то время года, в которое человеку был поставлен диагноз: те, кто узнал о своей болезни летом, имеют больше шансов выжить.

«Все это связано с витамином D, которого большинству людей не хватает», — говорит Кабаи.

Еще одна порция доказательств была получена в ходе исследования, опубликованного в прошлом году. Тридцати семи мужчинам с раком простаты давали либо препарат витамина D (примерно в семь раз больше рекомендуемой дневной нормы), либо плацебо.

Через шестьдесят дней им удалили простату. В группе, принимавшей витамин D, опухоли уменьшились, а в группе, принимавшей плацебо — увеличились.

Прием препарата также повлиял на экспрессию ключевых генов, «отключив» гены, связанные с воспалительными процессами, которые, как известно, способствуют развитию рака.

Другими словами, лысеющие люди могут быть склонны к раку простаты вопреки тому, что теряют волосы, а не из-за этого. Само по себе облысение может помочь снизить риск этого заболевания.

Это также может послужить ответом на вопрос, почему выводы ученых столь противоречивы: одно из исследований показало, что мужчины, которые к 30 годам имеют лысину, начинающуюся ото лба, или отдельные залысины, на 45% меньше рискуют заболеть раком простаты в будущем.

«Некоторые лысые мужчины предпочитают все время носить головной убор, другие — нет. Это различие могло стать источником неоднозначных выводов в подобных исследованиях», — говорит Кабаи.

Итак, лысина может помочь мужчине добиться успеха, внимания женщин или выздоровления.

Возможно, пришло время отказаться от голубиного помета и проявить в отношении лысых людей то уважение, которого они заслуживают.

Вечно молодой. Ученые выяснили, какие люди стареют медленно

https://ria.ru/20190209/1550556639.html

Вечно молодой. Ученые выяснили, какие люди стареют медленно

Вечно молодой. Ученые выяснили, какие люди стареют медленно — РИА Новости, 09.02.2019

Вечно молодой. Ученые выяснили, какие люди стареют медленно

Одни за год стареют как за три, для других время словно течет медленнее. Чаще всего дело в наследственности, но не только. Согласно сразу нескольким… РИА Новости, 09.02.2019

2019-02-09T08:00

2019-02-09T08:00

2019-02-09T08:01

наука

старение

гены

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdn25.img.ria.ru/images/155055/56/1550555634_179:0:3820:2048_1920x0_80_0_0_1955d396dee5a77e1728c8b48543c27b.jpg

МОСКВА, 9 фев — РИА Новости, Альфия Еникеева. Одни за год стареют как за три, для других время словно течет медленнее. Чаще всего дело в наследственности, но не только. Согласно сразу нескольким исследованиям, продлить молодость клеток и всего организма можно собственными силами.Не все стареют одинаково В 2015 году международная группа ученых из Университета Дьюка, Еврейского университета в Иерусалиме и Королевского колледжа в Лондоне анализировала данные примерно тысячи жителей небольшого новозеландского города Данидин, родившихся в 1972-1973 годах. На тот момент участникам эксперимента было от 26 до 38 лет, в течение двенадцати лет за ними пристально наблюдали. В начале исследования геронтологи замерили у испытуемых длину теломер — концевых участков хромосом, которые укорачиваются при каждом делении клетки и считаются одной из главных причин старения организма. Затем на протяжении десятилетия по 18 биомаркерам (артериальное давление, скорость обмена веществ, уровень холестерина, работа печени, легких, почек и прочее) регулярно высчитывались биологический возраст участников и скорость старения организма. Кроме того, все добровольцы в 38 лет прошли тест на определение психологического возраста.Оказалось, что некоторые испытуемые старели почти в три раза быстрее остальных, за двенадцать месяцев становясь как бы старше на три года. Другие, наоборот, «проживали» год за 16 с половиной месяцев. К моменту, когда участникам исследования исполнялось 38, их биологический возраст варьировался от 28 лет до 61 года. По мнению авторов работы, скорость старения испытуемых только на 20 процентов зависела от генетики. Большее значение имели занятия спортом, правильное питание, регулярные медицинские обследования и отказ от курения. Кроме того, быстрее старели те, чей психологический возраст обгонял фактический. Движение — жизнь Частично выводы коллег подтвердили биологи из Калифорнийского университета. Наблюдая за образом жизни полутора тысяч пожилых женщин старше 64 лет, они выяснили, что те, кто мало двигается, стареют быстрее. Биологический возраст клеток тех, кто находился в сидячем положении больше десяти часов в сутки, в среднем был на восемь лет больше, чем у их более активных ровесниц.Согласно исследованию бельгийских ученых, это может быть связано с тем, что физические упражнения и высокий уровень активности в пожилом возрасте активируют ген NFR1, защищающий концы молекул ДНК от повреждений.Кроме того, занятия спортом повышают активность тимуса — вилочковой железы, в которой стволовые клетки превращаются в Т-лимфоциты. С годами этот орган уменьшается в размерах, но, как показали британские исследователи, только не у активно занимающихся спортом. У таких людей даже в преклонном возрасте тимус производит столько же клеток иммунной системы, сколько у молодых, а уровень холестерина в крови намного ниже, чем у неспортивных ровесников. Кроме того, у мужчин-спортсменов сохраняется высокое содержание тестостерона.Меньше сахара, больше орехов Верный способ продлить молодость — есть как можно меньше сладкого, считают английские и немецкие генетики. Они посадили дрозофил на диету с высоким содержанием сахара и обнаружили, что это повлияло на работу гена FOXO, связанного со старением.Молодых плодовых мушек разделили на две группы. Одних кормили пищей с оптимальным содержанием сахара, а вторые получали еду, в которой сахара было в восемь раз больше нормы. Через три недели всех насекомых перевели на обычную диету. Тем не менее дрозофилы, переевшие в юном возрасте сладкого, умирали чаще, чем мушки из контрольной группы. Риск преждевременной смерти среди сладкоежек был выше почти на 50 процентов, и переход на здоровую пищу не улучшал выживаемость.По мнению авторов работы, избыток сахара подавил нормальную активность гена FOXO (у дрозофил — dFOXO, аналог человеческого FOXO1), который связывают с процессами старения. Вместо сахара ученые советуют продукты, богатые уролитином. Это соединение содержится в грецких орехах, гранатах и клубнике. После инъекций уролитина червячки-нематоды Caenorhabditis elegans живут в среднем на 45 процентов дольше, чем сородичи, а обыкновенные лабораторные мыши становятся на 42 процента выносливее. Продолжительность жизни значительно увеличивает перец чили, точнее, содержащийся в нем алкалоид капсаицин. Он препятствует ожирению, уменьшает риск развития сердечно-сосудистых и легочных заболеваний.Главное — не нервничать Чем меньше человек нервничает, тем медленнее стареет, полагают американские генетики. Депрессия и стресс могут вызывать изменения в работе гена ANK3, отвечающего за функционирование клеточных мембран. В норме активность этого гена повышается с годами, что приводит к одряхлению тела. Однако у людей, переживших серьезный стресс, депрессию, пытавшихся покончить с собой, наблюдается повышенная активность ANK3 уже в молодом возрасте, что оборачивается преждевременным старением.По мнению исследователей, ключ к долголетию может находиться именно в этом гене. Его отключение у нематод C. elegans значительно увеличило продолжительность их жизни. Похожим образом действовал и антидепрессант миансерин, снижавший активность ANK3 и продлевавший червям жизнь.

https://ria.ru/20181213/1547884007.html

https://ria.ru/20180310/1516087381.html

https://ria.ru/20160525/1439314105.html

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2019

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdn22.img.ria.ru/images/155055/56/1550555634_634:0:3365:2048_1920x0_80_0_0_19af21bbbdd7d7d259f2157d631909c6.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

старение, гены

МОСКВА, 9 фев — РИА Новости, Альфия Еникеева. Одни за год стареют как за три, для других время словно течет медленнее. Чаще всего дело в наследственности, но не только. Согласно сразу нескольким исследованиям, продлить молодость клеток и всего организма можно собственными силами.

Не все стареют одинаково

В 2015 году международная группа ученых из Университета Дьюка, Еврейского университета в Иерусалиме и Королевского колледжа в Лондоне анализировала данные примерно тысячи жителей небольшого новозеландского города Данидин, родившихся в 1972-1973 годах. На тот момент участникам эксперимента было от 26 до 38 лет, в течение двенадцати лет за ними пристально наблюдали.

В начале исследования геронтологи замерили у испытуемых длину теломер — концевых участков хромосом, которые укорачиваются при каждом делении клетки и считаются одной из главных причин старения организма. Затем на протяжении десятилетия по 18 биомаркерам (артериальное давление, скорость обмена веществ, уровень холестерина, работа печени, легких, почек и прочее) регулярно высчитывались биологический возраст участников и скорость старения организма. Кроме того, все добровольцы в 38 лет прошли тест на определение психологического возраста.

Оказалось, что некоторые испытуемые старели почти в три раза быстрее остальных, за двенадцать месяцев становясь как бы старше на три года. Другие, наоборот, «проживали» год за 16 с половиной месяцев. К моменту, когда участникам исследования исполнялось 38, их биологический возраст варьировался от 28 лет до 61 года.

По мнению авторов работы, скорость старения испытуемых только на 20 процентов зависела от генетики. Большее значение имели занятия спортом, правильное питание, регулярные медицинские обследования и отказ от курения. Кроме того, быстрее старели те, чей психологический возраст обгонял фактический.

13 декабря 2018, 08:00НаукаНа пути к бессмертию. Ученые нашли способ омолодить человеческие клетки

Движение — жизнь

Частично выводы коллег подтвердили биологи из Калифорнийского университета. Наблюдая за образом жизни полутора тысяч пожилых женщин старше 64 лет, они выяснили, что те, кто мало двигается, стареют быстрее. Биологический возраст клеток тех, кто находился в сидячем положении больше десяти часов в сутки, в среднем был на восемь лет больше, чем у их более активных ровесниц.Согласно исследованию бельгийских ученых, это может быть связано с тем, что физические упражнения и высокий уровень активности в пожилом возрасте активируют ген NFR1, защищающий концы молекул ДНК от повреждений.Кроме того, занятия спортом повышают активность тимуса — вилочковой железы, в которой стволовые клетки превращаются в Т-лимфоциты. С годами этот орган уменьшается в размерах, но, как показали британские исследователи, только не у активно занимающихся спортом. У таких людей даже в преклонном возрасте тимус производит столько же клеток иммунной системы, сколько у молодых, а уровень холестерина в крови намного ниже, чем у неспортивных ровесников. Кроме того, у мужчин-спортсменов сохраняется высокое содержание тестостерона.10 марта 2018, 17:00НаукаУченые выяснили, какой вид спорта помогает замедлить старение

Меньше сахара, больше орехов

Верный способ продлить молодость — есть как можно меньше сладкого, считают английские и немецкие генетики. Они посадили дрозофил на диету с высоким содержанием сахара и обнаружили, что это повлияло на работу гена FOXO, связанного со старением.

Молодых плодовых мушек разделили на две группы. Одних кормили пищей с оптимальным содержанием сахара, а вторые получали еду, в которой сахара было в восемь раз больше нормы. Через три недели всех насекомых перевели на обычную диету. Тем не менее дрозофилы, переевшие в юном возрасте сладкого, умирали чаще, чем мушки из контрольной группы. Риск преждевременной смерти среди сладкоежек был выше почти на 50 процентов, и переход на здоровую пищу не улучшал выживаемость.

По мнению авторов работы, избыток сахара подавил нормальную активность гена FOXO (у дрозофил — dFOXO, аналог человеческого FOXO1), который связывают с процессами старения. Вместо сахара ученые советуют продукты, богатые уролитином. Это соединение содержится в грецких орехах, гранатах и клубнике. После инъекций уролитина червячки-нематоды Caenorhabditis elegans живут в среднем на 45 процентов дольше, чем сородичи, а обыкновенные лабораторные мыши становятся на 42 процента выносливее. Продолжительность жизни значительно увеличивает перец чили, точнее, содержащийся в нем алкалоид капсаицин. Он препятствует ожирению, уменьшает риск развития сердечно-сосудистых и легочных заболеваний.25 мая 2016, 13:07НаукаГенетики выяснили, почему люди умирают и седеют от горяДепрессия и стресс сокращают жизнь и ускоряют старение благодаря тому, что они вызывают необычные изменения в работе гена ANK3 и ряда других участков ДНК фактически во всех органах тела.

Главное — не нервничать

Чем меньше человек нервничает, тем медленнее стареет, полагают американские генетики. Депрессия и стресс могут вызывать изменения в работе гена ANK3, отвечающего за функционирование клеточных мембран. В норме активность этого гена повышается с годами, что приводит к одряхлению тела. Однако у людей, переживших серьезный стресс, депрессию, пытавшихся покончить с собой, наблюдается повышенная активность ANK3 уже в молодом возрасте, что оборачивается преждевременным старением.

По мнению исследователей, ключ к долголетию может находиться именно в этом гене. Его отключение у нематод C. elegans значительно увеличило продолжительность их жизни. Похожим образом действовал и антидепрессант миансерин, снижавший активность ANK3 и продлевавший червям жизнь.

Выражения типа

Выражения типа

Выражения типа

  типxpr :
        '  идент.
   |  (  тип xpr  ) 
   |  typexpr   ->   typexpr 
   |  typexpr   {  *   typexpr  } + 
   |  typeconstr 
   |  typexpr   typeconstr 
   |  (  typexpr   { ,   typexpr  }  )   typeconstr  

В таблице ниже показаны относительные приоритеты и ассоциативность операторы и конструкции незамкнутого типа.Сооружения с более высокие приоритеты идут первыми.

Оператор Ассоциативность
Приложение конструктора типов
*
-> справа

Выражения типов обозначают типы в определениях типов данных, а также в ограничениях типов по шаблонам и выражениям.

Переменные типа

Выражение типа ' identity обозначает переменную типа с именем идент..В определениях типов данных переменные типа являются именами для параметры типа данных. В ограничениях типа они представляют неуказанные типы, которые могут быть созданы любым типом, чтобы удовлетворить типу ограничение.

Заключенные в скобки типы

Выражение типа ( typexpr ) обозначает тот же тип, что и типxpr .

Типы функций

Выражение типа typexpr 1 -> typexpr 2 обозначает тип функции, отображающие аргументы типа typexpr 1 на результаты типа типxpr 2 .

Типы кортежей

Выражение типа typexpr 1 * * typexpr n обозначает тип кортежей, элементы которых принадлежат типам typexpr 1 , … typexpr n соответственно.

Построенные виды

Конструкторы типов без параметров, как в typeconstr , являются типами выражения.

Выражение типа typexpr typeconstr , где typeconstr — это тип конструктор с одним параметром, обозначает применение унарного типа конструктор typeconstr к типу typexpr .

Выражение типа ( typexpr 1 , …, typexpr n ) typeconstr , где typeconstr — конструктор типа с n параметрами, обозначает применение конструктора n-арного типа typeconstr к типам typexpr 1 от до typexpr n .


Выражений — Руководство по Studio 9

1 Введение

Expressions изменяет значение на основе функции или комбинации функций.

Вы можете использовать выражения для рабочих процессов, страниц и микропотоков. Выражения обычно используются для настройки условия для определенного действия или свойства, например условия для принятия решения в микропотоке или рабочем процессе.

Вы можете использовать выражения для следующих элементов в рабочем процессе:

Выражения могут использоваться в следующих свойствах на странице:

  • Условная редактируемость виджета
  • Условная видимость виджета
  • Содержимое свойство текстового виджета

Выражения могут использоваться для следующих действий в микропотоке:

  • Изменить объект
  • Изменить переменную
  • Создать объект
  • Создать переменную
  • Решение
  • Конечное событие

Для получения дополнительной информации о настройке и изменении значений для микропотоков см. Установка и изменение значения для различных операций в микропотоках.

2 Написание выражения

Именованные элементы в микропотоках и рабочих процессах (например, объекты, списки или переменные) могут быть вызваны в выражении путем вставки имени элемента и добавления знака доллара (например, $ Клиент может ссылаться на объект с именем Заказчик ).

Доступ к атрибутам и ассоциациям объектов осуществляется с помощью косой черты (например, атрибут Имя объекта клиента обозначается как $ Customer / Name ).

Вы можете использовать скобки для определения приоритета и ассоциативности вычислений. Например, SellingPrice вычисляется на основе атрибутов Price и Discount по умолчанию:

  $ CurrentPrice / Цена - (($ CurrentPrice / Price ** div ** 100) * $ OrderLine / Discount)
  

Здесь комбинируются арифметические функции (вычитание, деление и умножение).

Вы не можете вводить простой текст в выражении, текст необходимо заключать в одинарные кавычки ( ') вокруг него.Например, если вы хотите вернуть строку Mendix , вам нужно записать ее как «Mendix» .

Вы можете использовать список предложений, которые помогут вам написать выражение. Используйте сочетание клавиш Ctrl + Пробел , чтобы отобразить этот список. Предложения можно разделить на следующие категории:

  • Переменные и их атрибуты — переменные или атрибуты, доступные в текущем микропотоке, на странице или в рабочем процессе
  • Значения перечисления — значения атрибутов перечислимого типа, которые могут использоваться в выражении
  • Функции — операции, которые можно использовать в выражении (дополнительные сведения см. В разделе «Типы выражений» ниже)
  • Ключевые слова — ключевые фразы или слова, которые можно использовать в выражении (например, пусто — значение, которое можно использовать для проверки того, пуста ли переменная)
  • Логические — истинные или ложные ключевые слова
  • Операторы — элементы кода, выполняющие логические или математические операции; вы можете использовать логические или реляционные выражения (дополнительные сведения см. в разделе «Типы выражений» ниже)

Если в выражении есть ошибки, место ошибки выделяется красным цветом, и при наведении курсора на него отображается сообщение об ошибке.В некоторых случаях доступны быстрые исправления, позволяющие быстро решить проблему.

2.3 Примеры выражений

Примеры, показывающие, как можно использовать выражения, описаны ниже.

2.3.1 Пример 1

У вас есть Решение в микропотоке, и вы хотите написать выражение, которое проверяет, является ли оценка клиента золотой, а цена заказа превышает 100 (вы можете настроить скидку после Решения , которая разрешена, если это выражение верно):

Выражение будет выглядеть следующим образом:

2.3.2 Пример 2

Вы добавляете Решение в микропоток, чтобы проверить, существует ли объект (в примере ниже объект Клиент ). И вы также проверяете, совпадает ли имя клиента с конкретным именем (в приведенном ниже примере имя клиента — Mendix ). Выражение будет выглядеть так:

2.3.3 Пример 3

У вас есть пользовательская задача в рабочем процессе, и вы хотите добавить Срок выполнения в качестве напоминания о том, что пользовательская задача должна быть выполнена послезавтра.Вы можете написать для него следующее выражение:

3 типа выражений

Список выражений, наиболее часто используемых в Studio, представлен ниже. Полный список доступных выражений см. В разделе «Выражения» в Studio Pro Guide .

3.1 Унарные выражения

3.2 Арифметические выражения

3.3 Выражения отношения

3.5 Логические выражения

3.6 Вызов математических функций

  • max — максимум списка номеров
  • мин — минимум списка номеров
  • round — округляет число до определенной точности
  • random — генерация случайных чисел
  • этаж — округление числа с плавающей запятой в меньшую сторону
  • ceil — округление числа с плавающей запятой в большую сторону
  • pow — возведение в степень
  • абс — абсолютное значение

3.7 вызовов строковых функций

  • toUpperCase — преобразует строку в верхний регистр
  • toLowerCase — преобразует строку в нижний регистр
  • length — длина строки
  • подстрока — получает часть строки
  • find — получает позицию подстроки
  • findLast — получает последнюю позицию подстроки
  • содержит — содержит подстроку
  • startWith — определяет, начинается ли строка с указанной подстроки
  • endWith — определяет, заканчивается ли строка указанной подстрокой
  • обрезать — удаляет начальные и конечные пробелы
  • replaceAll — заменяет вхождения подстроки
  • replaceFirst — заменяет первое вхождение подстроки
  • Объединение строк (+) — объединяет строки

3.8 Дата создания

  • dateTime — создание значения даты с использованием календаря сервера

3.9 Между вызовами функции даты

3.10 Вызов функции добавления даты

3.11 Синтаксический анализ и форматирование десятичных вызовов функций

4 Подробнее

Документация

Learning with Python 2nd Edition

2.1. Значения и типы данных

Значение — это одна из основных вещей, например, буква или цифра. что программа манипулирует.До сих пор мы видели значения 2 ( результат, когда мы сложили 1 + 1) и «Hello, World!».

Эти значения принадлежат к разным типам данных : 2 — целое число , и «Привет, мир!» является строкой , так называемой, потому что она содержит строку письма. Вы (и интерпретатор) можете идентифицировать строки, потому что они заключен в кавычки.

Оператор печати также работает с целыми числами.

Если вы не уверены, какой тип имеет значение, интерпретатор может сказать ты.

 >>> type ("Hello, World!")
<тип 'str'>
>>> тип (17)
<тип int>
 

Неудивительно, что строки принадлежат типу str , а целые числа принадлежат типу тип внутр . Менее очевидно, что числа с десятичной точкой относятся к типу называется с плавающей запятой , потому что эти числа представлены в формате, называемом с плавающей точкой .

 >>> тип (3.2)
<тип 'float'>
 

А как насчет таких значений, как «17» и «3».2 «? Они выглядят как числа, но они находятся в кавычках, как строки.

 >>> тип ("17")
<тип 'str'>
>>> тип ("3.2")
<тип 'str'>
 

Это струны.

Строки в Python могут быть заключены в одинарные кавычки (‘) или двойные кавычки. (”):

 >>> type ('Это строка.')
<тип 'str'>
>>> type ("И это тоже.")
<тип 'str'>
 

Строки в двойных кавычках могут содержать внутри одинарные кавычки, как в «Борода Брюса», а строки в одинарных кавычках могут иметь двойные кавычки. внутри них, как в «Рыцари, которые говорят« Ни! »».

Когда вы вводите большое целое число, у вас может возникнуть соблазн использовать запятые между группы из трех цифр, как в 1,000,000. Это недопустимое целое число в Python, но это законно:

 >>> распечатать 1,000,000
1 0 0
 

Ну, это совсем не то, чего мы ожидали! Python интерпретирует 1000000 как список из трех предметов для печати. Так что не забывайте запятые в целые числа.

2.2. Переменные

Одна из самых мощных функций языка программирования — это способность манипулировать переменными .Переменная — это имя, которое относится к значению.

Оператор присваивания создает новые переменные и дает им значения:

 >>> message = "Как дела, Док?"
>>> п = 17
>>> пи = 3,14159
 

В этом примере выполняются три назначения. Первый присваивает строку «Что вверх, Doc? «в новую переменную с именем message. Вторая возвращает целое число 17 в n, а третий дает число с плавающей запятой 3.14159 в Пи.

Оператор присваивания , =, не следует путать со знаком равенства. (даже если в нем используется тот же символ).Операторы присваивания связывают имя , слева от оператора, со значением , справа. Вот почему вы получите сообщение об ошибке, если введете:

Распространенный способ представить переменные на бумаге — написать имя стрелкой. указывая на значение переменной. Такая фигура называется состоянием диаграмма , потому что она показывает, в каком состоянии находится каждая из переменных (подумайте об этом как душевное состояние переменной). На этой диаграмме показан результат операторы присваивания:

Оператор печати также работает с переменными.

 >>> распечатать сообщение
Что случилось док?
>>> напечатайте n
17
>>> выведите пи
3,14159
 

В каждом случае результатом является значение переменной. Переменные также имеют типы; опять же, мы можем спросить переводчика, что это такое.

 >>> тип (сообщение)
<тип 'str'>
>>> тип (n)
<тип int>
>>> тип (пи)
<тип 'float'>
 

Тип переменной — это тип значения, к которому она относится.

2.3. Имена переменных и ключевые слова

Программисты обычно выбирают имена для своих переменных, которые имеют смысл — они документируют, для чего используется переменная.

Имена переменных могут быть произвольно длинными. Они могут содержать как буквы, так и числа, но они должны начинаться с буквы. Хотя использование разрешено прописные буквы, по соглашению мы не используем. Если да, вспомни тот случай имеет значение. Брюс и Брюс — разные переменные.

В имени может присутствовать символ подчеркивания (_). Часто используется в имена, состоящие из нескольких слов, например my_name или price_of_tea_in_china.

Если вы дадите переменной недопустимое имя, вы получите синтаксическую ошибку:

 >>> 76trombones = "большой парад"
SyntaxError: недопустимый синтаксис
>>> еще $ = 1000000
SyntaxError: недопустимый синтаксис
>>> class = "Информатика 101"
SyntaxError: недопустимый синтаксис
 
Номер

76trombones является незаконным, потому что он не начинается с буквы.больше $ является незаконным, поскольку содержит недопустимый символ — знак доллара. Но что не так с классом?

Оказывается, class является одним из ключевых слов Python . Ключевые слова определяют правила и структура языка, и их нельзя использовать в качестве имен переменных.

Python имеет тридцать одно ключевое слово:

и как утверждать перерыв класс продолжить
деф del Элиф еще кроме исполнительный
наконец для из глобальный, если импорт
дюйм это лямбда не или проезд
печать поднять возврат попробовать, а с
выход

Вы можете держать этот список под рукой.Если переводчик жалуется на одного имен ваших переменных, и вы не знаете почему, посмотрите, есть ли она в этом списке.

2.4. Выписки

Оператор — это инструкция, которую может выполнить интерпретатор Python. Мы видели два вида операторов: печать и присваивание.

Когда вы вводите оператор в командной строке, Python выполняет его и отображает результат, если он есть. Результатом оператора печати является значение. Заявления о назначении не дают результата.

Сценарий обычно содержит последовательность операторов. Если их больше одного оператор, результаты появляются по одному по мере выполнения операторов.

Например, скрипт

выдает результат:

Опять же, оператор присваивания ничего не выводит.

2,5. Вычисление выражений

Выражение — это комбинация значений, переменных и операторов. если ты введите выражение в командной строке, интерпретатор вычислит его и отображает результат:

Оценка выражения дает значение, поэтому выражения может появляться справа от операторов присваивания.Ценность все по сам по себе является простым выражением, как и переменная.

Как ни странно, оценка выражения — это не совсем то же самое, что печать ценить.

 >>> message = "Как дела, Док?"
>>> сообщение
"Что случилось док?"
>>> распечатать сообщение
Что случилось док?
 

Когда оболочка Python отображает значение выражения, она использует то же формат, который вы использовали бы для ввода значения. В случае строк это означает, что он включает кавычки.Но оператор печати выводит значение выражение, которое в данном случае является содержимым строки.

В сценарии выражение само по себе является законным утверждением, но не Делать что-нибудь. Скрипт

 17
3.2
"Привет, мир!"
1 + 1
 

вообще не выводит ничего. Как бы вы изменили сценарий для отображения значения этих четырех выражений?

2.6. Операторы и операнды

Операторы — это специальные символы, которые представляют вычисления, такие как сложение и умножение.Значения, которые использует оператор, называются операндами .

Ниже приведены все допустимые выражения Python, значение которых более или менее ясно:

 20 + 32 час-1 час * 60 + минута минута / 60 5 ** 2 (5 + 9) * (15-7)
 

Символы +, — и /, а также использование скобок для группировки, означают в Python то, что они означают в математике. Звездочка (*) — это символ умножения, а ** символ возведения в степень.

Когда имя переменной появляется вместо операнда, оно заменяется на его значение до выполнения операции.

Сложение, вычитание, умножение и возведение в степень — все делают то, что вы ожидайте, но вы можете быть удивлены разделением. Следующая операция имеет неожиданный результат:

 >>> минута = 59
>>> минут / 60
0
 

Значение минуты равно 59, а 59, разделенное на 60, дает 0,98333, а не 0. Причина расхождения в том, что Python выполняет целочисленное деление на .

Если оба операнда являются целыми числами, результат также должен быть целым числом, и по соглашению, целочисленное деление всегда округляет до , даже в таких случаях где следующее целое число очень близко.

Возможное решение этой проблемы — вычислить процент, а не фракция:

Снова результат округляется в меньшую сторону, но, по крайней мере, теперь ответ примерно верный. Другой альтернативой является использование деления с плавающей запятой. Мы увидим в глава 4 как преобразовать целочисленные значения и переменные в числа с плавающей запятой ценности.

2.7. Порядок работы

Если в выражении присутствует более одного оператора, порядок оценки зависит от правил приоритета .Python следует тому же приоритету правила для своих математических операторов, которые делает математика. Аббревиатура PEMDAS полезный способ запомнить порядок операций:

  1. P аренты имеют наивысший приоритет и могут использоваться для принудительного выполнения выражение для оценки в желаемом порядке. Поскольку выражения в скобки оцениваются первыми, 2 * (3-1) равно 4, а (1 + 1) ** (5-2) равно 8. Вы также можете использовать круглые скобки, чтобы облегчить чтение выражения, как в (минута * 100) / 60, даже если результат не изменится.
  2. E xponentiation имеет следующий высший приоритет, поэтому 2 ** 1 + 1 равно 3 и не 4, а 3 * 1 ** 3 равно 3, а не 27.
  3. M ultiplication и D ivision имеют одинаковый приоритет, который выше, чем A ddition и S ubtraction, которые также имеют одинаковые приоритет. Таким образом, 2 * 3-1 дает 5, а не 4, а 2 / 3-1 равно -1, а не 1 (помните, что при целочисленном делении 2/3 = 0).
  4. Операторы с одинаковым приоритетом оцениваются слева направо.Так что в выражение минута * 100/60, умножение происходит первым, давая 5900/60, что, в свою очередь, дает 98. Если бы операции были оценены из справа налево, результат был бы 59 * 1, то есть 59, то есть неправильный.

2,8. Операции над строками

В общем, вы не можете выполнять математические операции со строками, даже если строки выглядят как числа. Следующее недопустимо (при условии, что сообщение имеет строку типа):

 сообщение-1 «Привет» / 123 сообщение * «Привет» «15» +2
 

Интересно, что оператор + работает со строками, но не делайте именно то, что вы можете ожидать.Для строк оператор + представляет конкатенация , что означает соединение двух операндов путем их связывания. концы с концами. Например:

 fruit = "банан"
baked_good = "ореховый хлеб"
печать фруктов + baked_good
 

Результатом этой программы является банановый ореховый хлеб. Пробел перед словом гайка является частью струны и необходима для создания промежутка между сцепленные строки.

Оператор * также работает со строками; он выполняет повторение. Например, «Fun» * 3 — это «FunFunFun».Один из операндов должен быть строкой; в other должно быть целым числом.

С одной стороны, такая интерпретация + и * имеет смысл по аналогии с сложение и умножение. Так же, как 4 * 3 эквивалентно 4 + 4 + 4, мы ожидайте, что «Fun» * 3 будет таким же, как «Fun» + «Fun» + «Fun», и это так. На с другой стороны, существует значительный способ конкатенации строк и повторение отличается от целочисленного сложения и умножения. Ты можешь подумайте о том, что сложение и умножение имеют эту строку конкатенации и повторения нет?

2.9. Ввод

.

В Python есть две встроенные функции для ввода с клавиатуры:

 n = raw_input ("Пожалуйста, введите ваше имя:")
напечатать n
n = input ("Введите числовое выражение:")
напечатать n
 

Пример выполнения этого сценария будет выглядеть примерно так:

 $ python tryinput.py
Пожалуйста, введите свое имя: Артур, король бриттов
Артур, король бриттов
Введите числовое выражение: 7 * 3
21 год
 

Каждая из этих функций позволяет передать подсказку функции между круглые скобки.

2.10. Композиция

Итак, мы рассмотрели элементы программы — переменные, выражения, а высказывания — по отдельности, не говоря о том, как их совместить.

Одной из наиболее полезных функций языков программирования является их способность возьмите небольшие строительные блоки и из составьте их. Например, мы умеем складываем числа, и мы умеем печатать; оказывается, мы можем делать и то, и другое одновременно время:

На самом деле добавление должно происходить до печати, поэтому действия на самом деле не происходят одновременно.Дело в том, что любое выражение с числами, строками и переменными можно использовать внутри оператора печати. Вы уже видели пример этого:

 print «Количество минут с полуночи:», час * 60 + минута
 

Вы также можете помещать произвольные выражения в правую часть присваивания. выписка:

 процентов = (минуты * 100) / 60
 

Эта способность сейчас может показаться не впечатляющей, но вы увидите другие примеры, где композиция позволяет аккуратно выражать сложные вычисления и лаконично.

Предупреждение. Существуют ограничения на использование определенных выражений. Для Например, левая часть оператора присваивания должна быть переменная имя, а не выражение. Итак, следующее незаконно: минута + 1 = час.

2.12. Глоссарий

оператор присваивания
= — это оператор присваивания Python, который не следует путать с математическим оператором сравнения, использующим тот же символ.
заявление о присвоении

Оператор, присваивающий значение имени (переменной).Слева от оператор присваивания = — это имя. Справа от оператор присваивания — это выражение, которое вычисляется Python переводчик, а затем присваивается имя. Разница между левая и правая части оператора присваивания часто сбивает с толку новых программистов. В следующем задании:

n играет совершенно разные роли по обе стороны от знака =. На справа это значение и составляет часть выражения , которое будет быть оцененным интерпретатором Python перед присвоением его имени налево.

Информация в программе, предназначенная для других программистов (или кого-либо чтение исходного кода) и не влияет на выполнение программа.
состав
Возможность комбинировать простые выражения и утверждения в составные операторы и выражения для представления сложных вычислений лаконично.
объединить
Для соединения двух струн встык.
тип данных
Набор значений. Тип значения определяет, как его можно использовать в выражения.До сих пор вы видели целые числа (введите int), числа с плавающей запятой (тип float) и строки (тип ул).
оценить
Чтобы упростить выражение, выполнив операции, чтобы дают одно значение.
выражение
Комбинация переменных, операторов и значений, представляющая единственное значение результата.
поплавок
Тип данных Python, в котором хранится чисел с плавающей запятой, чисел. Числа с плавающей запятой хранятся внутри в двух частях: основание , и показатель степени .При печати в стандартном формате они выглядят как десятичные числа. Остерегайтесь ошибок округления при использовании чисел с плавающей запятой, и помните, что это только приблизительные значения.
внутренний
Тип данных Python, содержащий положительные и отрицательные целые числа.
целочисленное деление
Операция, которая делит одно целое число на другое и возвращает целое число. Целочисленное деление дает только то количество раз, которое числитель делится на знаменатель и отбрасывает остаток.
ключевое слово
Зарезервированное слово, используемое компилятором для анализа программы; ты нельзя использовать такие ключевые слова, как if, def и while, в качестве переменных имена.
операнд
Одно из значений, над которыми работает оператор.
оператор
Специальный символ, представляющий простое вычисление, такое как сложение, умножение или конкатенация строк.
правила старшинства
Набор правил, определяющих порядок, в котором выражения, включающие оцениваются несколько операторов и операндов.
диаграмма состояний
Графическое представление набора переменных и значений для на которые они ссылаются.
Заявление
Инструкция, которую может выполнить интерпретатор Python. Примеры операторы включают оператор присваивания и оператор печати.
ул.
Тип данных Python, содержащий строку символов.
значение
Число или строка (или другие названия, которые будут названы позже), которые могут быть хранится в переменной или вычисляется в выражении.
переменная
Имя, относящееся к значению.
имя переменной
Имя, присвоенное переменной. Имена переменных в Python состоят из последовательность букв (a..z, A..Z и _) и цифр (0..9), которая начинается с письмом. В лучшей практике программирования имена переменных должны быть выбраны так, чтобы они описывали свое использование в программе, делая программа самодокументирующая .

2.13. Упражнения

  1. Запишите, что происходит при печати оператора присваивания:

    Как насчет этого?

    Или это?

     >>> печать 5.2, «это», 4–2, «то», 5 / 2,0
     

    Можете ли вы придумать общее правило того, что может следовать за печатью? утверждение? Что возвращает оператор печати?

  2. Возьмите приговор: Всякая работа и никакие развлечения делают Джека скучным мальчиком. Сохраните каждое слово в отдельной переменной, затем распечатайте предложение на одна строка с использованием печати.

  3. Добавьте круглые скобки к выражению 6 * 1-2, чтобы изменить его значение. от 4 до -6.

  4. Поместите комментарий перед строкой кода, которая ранее работала, и запишите, что происходит при повторном запуске программы.

  5. Разница между input и raw_input заключается в том, что input оценивает входную строку, а raw_input — нет. Попробуйте следующее в интерпретаторе и запишите, что происходит:

     >>> x = вход ()
    3,14
    >>> тип (x)
     
     >>> х = raw_input ()
    3,14
    >>> тип (x)
     
     >>> x = вход ()
    «Рыцари, которые говорят« ни! »»
    >>> х
     

    Что произойдет, если вы попробуете приведенный выше пример без кавычек?

     >>> x = вход ()
    Рыцари, которые говорят "ни!"
    >>> х
     
     >>> х = raw_input ()
    «Рыцари, которые говорят« ни! »»
    >>> х
     

    Опишите и объясните каждый результат.

  6. Запустите интерпретатор Python и введите в командной строке bruce + 4. Это даст вам ошибку:

     NameError: имя 'Брюс' не определено
     

    Присвойте Брюсу значение, чтобы Брюс + 4 оценивался как 10.

  7. Напишите программу (сценарий Python) с именем madlib.py, которая запрашивает пользователь может ввести ряд существительных, глаголов, прилагательных, наречий, множественного числа существительные, глаголы прошедшего времени и т. д., а затем генерирует абзац, который синтаксически правильный, но семантически нелепый (см. http: // madlibs.org для примеров).

выражений — язык конфигурации — Terraform от HashiCorp

Практическое руководство: Попробуйте учебное пособие по созданию динамических выражений на сайте HashiCorp Learn.

Выражения используются для ссылки или вычисления значений в конфигурации. Простейшие выражения — это просто буквальные значения, например "hello" или 5 , но язык Terraform также допускает более сложные выражения, такие как ссылки на данные, экспортируемые по ресурсам, арифметика, условная оценка, и ряд встроенных функций.

Выражения могут использоваться в разных местах языка Terraform, но некоторые контексты ограничивают допустимые конструкции выражений, например, требовать буквального значения определенного типа или запрещать ссылки на атрибуты ресурса. Документация по каждой языковой функции описывает любые ограничения, на которые она накладывает выражения.

Вы можете поэкспериментировать с поведением выражений Terraform из консоль выражения Terraform, запустив команда terraform console .

На других страницах этого раздела описаны особенности Terraform’s синтаксис выражения.

  • Типы и значения документирует типы данных, в которые могут разрешаться выражения Terraform, и буквальные синтаксисы для значений этих типов.

  • Строки и шаблоны документирует синтаксис строковых литералов, включая последовательности интерполяции и директивы шаблона.

  • Ссылки на значения документы, как обращаться к именованным значениям, таким как переменные и атрибуты ресурсов.

  • Операторы документирует арифметические, сравнительные и логические операторы.

  • Вызов функций документирует синтаксис для вызова встроенных функций Terraform.

  • Условные выражения документы <СОСТОЯНИЕ>? <ИСТИННОЕ ЗНАЧЕНИЕ>: <ЛОЖНОЕ ЗНАЧЕНИЕ> выражение, которое выбирает одно из двух значений на основе логического условия.

  • Для выражений документирует такие выражения, как [for s в var.list: upper (s)] , который может преобразовать значение сложного типа в значение другого сложного типа.

  • Выражения Splat документы такие выражения, как var.list [*]. id , которые могут извлекать более простые коллекции из более сложных выражений.

  • Динамические блоки документирует способ создания нескольких повторяемых вложенных блоков внутри ресурса или другая конструкция.

  • Типовые ограничения документирует синтаксис для ссылки на тип, а не его значение тип.Входные переменные ожидают этот синтаксис в своем аргументе типа .

  • Ограничения версии документирует синтаксис специальных строк, которые определяют набор разрешенного программного обеспечения версии. Terraform использует ограничения версии в нескольких местах.

Текстовые выражения | Справочный центр AppSheet

Текстовое значение — это последовательность букв, цифр, знаков препинания, эмодзи, пробелов или других символов, которая не распознается как другое ключевое слово или оператор типа данных или выражения.

Текстовое выражение — это выражение, которое создает текстовое значение или использует одно или несколько текстовых значений для создания значения любого типа.

Базовый тип текстовых данных — Text , который может содержать только одну строку текста. Тип данных LongText позволяет использовать несколько строк текста. Несколько других типов столбцов, включая Address , Email и Name , имеют дополнительные характеристики, но по сути являются текстовыми значениями и могут использоваться как таковые в выражениях.

Создание текста

Создание необработанного текстового значения

В выражении, как правило, AppSheet обрабатывает любую последовательность букв, цифр, знаков препинания, эмодзи или других непробельных символов как Text , если не распознается как что-то еще , например значение Date , Decimal , Number или Time , либо ключевое слово или оператор выражения.

Чтобы AppSheet распознал необработанное текстовое значение в выражении, исходное текстовое значение должно быть заключено в двойные кавычки:

Некоторые слова, обычно используемые в качестве имен столбцов, можно спутать с ключевыми словами выражения.Во избежание путаницы лучше всегда заключать необработанные текстовые значения в двойные кавычки:

  • «Дата»

  • «DateTime»

  • «Десятичный»

  • «Число»

  • «Текст»

  • «Время»

Чтобы включить пробелы в начале или конце необработанного текстового значения или нескольких последовательных пробелов внутри, исходное значение должно быть двойным -quoted:

  • «пробел перед»

  • « пробел после»

Для распределения текста по нескольким строкам (как для значения LongText ), все многострочное необработанное значение должно быть заключено в двойные кавычки:

  "Это значение 
распределено на
строк по строкам."

В случае сомнений, если вы хотите, чтобы исходное значение обрабатывалось как текстовое значение, заключите его в двойные кавычки.

Создание текстового значения с конкатенацией

Два или более текстовых значения могут быть объединены для создания нового текстового значения. значение с использованием конкатенации . Функция CONCATENATE () выполняет следующее:

  • CONCATENATE («ABC», «123») дает ABC123 .

  • CONCATENATE («Hi,» Имя], "", [Фамилия], "!") может дать Привет, Джон Смит!

Оператор объединения текста (& ) — это короткий способ объединения двух значений :

  • («ABC» и «123») дает ABC123 .

  • ("Привет," & [Имя] & "" & [Фамилия] & "!") может дать Привет, Джон Смит!

Создание текстового значения с помощью функции

Ряд функций выдают текстовые результаты:

  • СЦЕПИТЬ () — Текст из текстовых фрагментов.

  • ENCODEURL () — закодированный текст для использования в URL.

  • INITIALS () — Первый символ каждого слова в текстовом значении.

  • LEFT () — Крайние левые последовательные символы из текстового значения.

  • LINKTEXT () — Текстовый компонент гиперссылки.

  • LOWER () — текстовое значение со всеми буквами в нижнем регистре.

  • MID () — последовательные символы из текстового значения.

  • RIGHT () — Крайние правые последовательные символы из текстового значения.

  • SUBSTITUTE () — текстовое значение с замененным фрагментом другим.

  • TEXT () — Текстовое представление любого значения.

  • TRIM () — текстовое значение с удаленными лишними пробелами.

  • UNIQUEID () — Случайное текстовое значение, подходящее для ID.

  • UPPER () — текстовое значение со всеми буквами в верхнем регистре.

Создание текстового значения из нетекстового значения

В определенных местах внутри выражений и в других функциях AppSheet могут потребоваться текстовые значения, но данные, которые вы хотите использовать, хранятся в столбце нетекстового типа , например Decimal или DateTime .Существует несколько способов преобразовать нетекстовые значения в Text :

  • TEXT () function: Использование нетекстового значения с функцией TEXT () (например, TEXT ([My Data] ) ) создает новое текстовое значение из исходного значения, отформатированное соответствующим образом. Результат будет локализован, что может повлиять на отображение даты, времени, чисел, десятичных знаков и валюты. Если исходное значение является значением столбца (например, не исходным значением или результатом выражения), также будут применяться любые настройки отображения для конкретного столбца, такие как количество цифр, точность до десятичной дроби, точность времени и подробность даты. .

  • Функция CONCATENATE (): Использование нетекстового значения с функцией CONCATENATE () (например, CONCATENATE ([Мои данные]) ) или с оператором объединения текста (например, , ([Мои данные] & "") ) создает новое текстовое значение, используя точный текст исходного значения (необработанное значение или значение, хранящееся в электронной таблице или другом хранилище данных под таблицей приложения) . Обратите внимание, что при использовании этого метода не применяет зависящие от столбца предпочтения отображения (например, количество цифр, десятичную точность, точность времени и подробность даты), , а также не локализованный результат (что может повлиять на внешний вид дат, времени , числа, десятичные дроби и валюта).

  • Другие функции: Ряд других функций, предназначенных для работы с текстовыми значениями, могут принимать нетекстовые значения и давать разумные текстовые результаты. Не рекомендуется использовать нетекстовые значения напрямую с функциями, предназначенными для текстовых значений. Вместо этого рассмотрите возможность использования TEXT () или CONCATENATE () , как описано выше, чтобы сначала преобразовать нетекстовое значение.

Использование текста

Использование текстовых выражений для настройки сообщений

Текст многих сообщений, отображаемых AppSheet для пользователя приложения, можно настроить, выбрав UX >> Локализовать в редакторе приложения.

По умолчанию пользовательский текст сообщения предоставляется как необработанное значение, но может быть сгенерирован с выражением путем переключения с карандаша (необработанного) на колбу (выражение):

Обычно используется для локализации сообщений в предпочтительный язык пользователя. В приложении, предназначенном для работы с несколькими языками, может быть таблица, специально содержащая текст перевода (например, Translations ), где каждая строка предназначена для определенного языка (указанного в столбце Language , e.g.), а каждый столбец — это перевод конкретного сообщения. Следующее выражение может затем использоваться для предоставления локализованного текста для сообщения Syncing the app в соответствии с предпочтительным языком пользователя (например, из пользовательских настроек Language ):

  LOOKUP (
USERSETTINGS («Язык») ,
«Перевод»,
«Язык»,
«Синхронизация приложения»
)

См. Также: ПРОСМОТР () , НАСТРОЙКИ ПОЛЬЗОВАТЕЛЯ ()

Использование текстовых значений в функциях

Различные функции принимают текстовый ввод:

3.Выражения — Справочное руководство по бережливому производству 3.3.0 документация

3.1. Вселенные

Каждый тип в Lean по определению является выражением типа Sort u для некоторого уровня юниверса и . Уровень вселенной может быть одним из следующих:

  • натуральное число, n
  • переменная юниверса, u (объявляется с помощью команды universe или юниверсов )
  • выражение u + n , где u — уровень вселенной, а n — натуральное число
  • выражение max u v , где u и v — это вселенные
  • выражение imax u v , где u и v — уровни вселенной

Последний обозначает уровень юниверса 0 , если v равно 0 , и max u v в противном случае.

 вселенных u v

#check Sort u
#check Sort 5
#check Sort (u + 1)
#check Sort (u + 3)
#check Sort (max u v)
#check Sort (max (u + 3) v)
#check Sort (imax (u + 3) v)
#check Prop
#check Type
 

3.2. Синтаксис выражения

Набор выражений в Lean индуктивно определяется следующим образом:

  • Сортировка u : вселенная типов на уровне вселенной u
  • c : где c — идентификатор, обозначающий аксиоматически объявленную константу или определенный объект
  • x : где x — переменная в локальном контексте, в которой интерпретируется выражение
  • Π x: α, β : тип функций, переводящих элемент x из α в элемент β , где β — это выражение с типом Sort
  • s t : результат применения s к t , где s и t являются выражениями
  • λ x: α, t : функция, отображающая любое значение x типа α в t , где t — это выражение
  • let x: = t in s : локальное определение, обозначает значение s , когда x заменяется на t

Каждый правильно сформированный термин в Lean имеет тип , который сам по себе является выражением типа Sort u для некоторых и .Тот факт, что член t имеет тип α , записывается t: α .

Чтобы выражение было правильно сформировано, его компоненты должны удовлетворять определенным ограничениям ввода. Они, в свою очередь, определяют тип результирующего члена следующим образом:

  • Сортировать u: Сортировать (u + 1)
  • c: α , где α — это тип, для которого c был объявлен или определен как имеющий
  • x: α , где α — это тип, присвоенный x в локальном контексте, где он интерпретируется
  • (Π x: α, β): Сортировка (imax u v) , где α: Сортировка u и β: Сортировка v при условии x: α
  • s t: β [t / x] , где s имеет тип Π x: α, β и t имеет тип α
  • (λ x: α, t): Π x: α, β , если t имеет тип β всякий раз, когда x имеет тип α
  • (пусть x: = t в с): β [t / x] , где t имеет тип α и s имеет тип β при условии x: α

Prop сокращает Сортировка 0 , Тип сокращает Сортировка 1 и Тип u сокращает Сортировка (u + 1) , когда u — переменная юниверса.Мы говорим « α — это тип», чтобы выразить α: введите u для некоторого u , и мы говорим « p — это предложение», чтобы выразить p: Prop . Используя предложения в качестве соответствия типов , для данного p: Prop , мы ссылаемся на выражение t: p как на доказательство из p . Напротив, для α: Type u для некоторых u и t: α мы иногда называем t как data .

Когда выражение β в Π x: α, β не зависит от x , можно записать α → β . Как обычно, переменная x связана с Π x: α, β , λ x: α, t и let x: = t в s . Выражение x: α, β является альтернативным синтаксисом для Π x: α, β и предназначено для использования, когда β является предложением. Подчеркивание можно использовать для создания внутренней переменной в подшивке, как в λ _: α, t .

В дополнение к элементам, указанным выше, выражения могут также содержать метапеременные , то есть временные заполнители, которые используются в процессе построения терминов. Они также могут содержать макросы , которые используются для аннотирования или сокращения терминов. Термины, добавленные в среду, не содержат ни метапеременных, ни переменных, то есть они полностью разработаны и имеют смысл в пустом контексте.

Константы

могут быть объявлены различными способами, например, с помощью ключевых слов константы и аксиомы или как результат объявления индуктивной структуры или структуры .Точно так же объекты можно определять различными способами, например, с помощью def , , теоремы или компилятора уравнений. См. Главу 4 для получения дополнительной информации.

Запись выражения (t: α) заставляет Lean уточнять t так, чтобы оно имело тип α , или сообщать об ошибке в случае сбоя.

Lean поддерживает анонимную нотацию конструктора, анонимные проекции и различные формы синтаксиса сопоставления, включая деструктуризацию λ и let .Они, а также обозначения для общих типов данных (таких как пары, списки и т. Д.) Обсуждаются в главе 4 в связи с индуктивными типами.

 вселенных u v w

переменные (p q: Prop)
переменная (α: Тип u)
переменная (β: Тип v)
переменная (γ: α → Тип w)
переменная (η: α → β → Тип w)

постоянные δ ε: Тип u
константы cnst: δ
постоянная f: δ → ε

переменные (a: α) (b: β) (c: γ a) (d: δ)

переменная g: α → β
переменная h: Π x: α, γ x
переменная h ': Π x, γ x → δ

#check Sort (u + 3)
#check Prop
# проверить Π x: α, γ x
#check f cnst
# проверить λ x, h x
# проверить λ x, h 'x (h x)
#check (λ x, h x) a
# проверить λ _: ℕ, 5
# проверьте let x: = a in h x

# проверить Π x y, η x y
# проверить Π (x: α) (y: β), η x y
# проверить λ x y, η x y
# проверить λ (x: α) (y: β), η x y
# проверьте let x: = a, y: = b в η x y

#check (5: ℕ)
#check (5: (λ x, x) ℕ)
#check (5: ℤ)
 

3.3. Неявные аргументы

При объявлении аргументов для определенных объектов в Lean (например, с def , теоремой , постоянной , индуктивной или структурой ; см. Главу 4) или при объявлении переменных и параметров в разделах (см. 5), аргументы могут быть аннотированы как явный или неявный . Это определяет, как интерпретируются выражения, содержащие объект.

  • (x: α) : явный аргумент типа α
  • {x: α} : неявный аргумент, быстро вставлен
  • ⦃x: α⦄ или {{x: α}} : неявный аргумент, вставлен слабо
  • [x: α] : неявный аргумент, который должен выводиться разрешением класса типа
  • (x: α: = t) : необязательный аргумент со значением по умолчанию t
  • (х: α.t) : неявный аргумент, синтезируемый тактикой t

Имя переменной можно не указывать в аргументе разрешения класса, и в этом случае создается внутреннее имя.

Когда функция имеет явный аргумент, вы тем не менее можете попросить разработчика Lean вывести аргумент автоматически, введя его как знак подчеркивания ( _ ). Напротив, запись @foo указывает на то, что все аргументы, которые должны быть foo , должны быть указаны явно, независимо от того, как было объявлено foo .

 вселенная u

def ex1 (x y z: ℕ): ℕ: = x + y + z

#check ex1 1 2 3

def id1 (α: Тип u) (x: α): α: = x

#check id1 nat 3
#check id1 _ 3

def id2 {α: Тип u} (x: α): α: = x

#check id2 3
#check @ id2 ℕ 3
#check (id2: ℕ → ℕ)

def id3 {{α: Тип u}} (x: α): α: = x

#check id3 3
#check @ id3 ℕ 3
#check (id3: Π α: Тип, α → α)

класс cls: = (val: ℕ)
экземпляр cls_five: cls: = ⟨5⟩

def ex2 [c: cls]: ℕ: = c.val

пример: ex2 = 5: = rfl

def ex2a [cls]: ℕ: = ex2

пример: ex2a = 5: = rfl

def ex3 (x: ℕ: = 5): = x

#check ex3 2
#check ex3
пример: ex3 = 5: = rfl

meta def ex_tac: тактическая единица: = тактика.уточнить '' (5)

def ex4 (x: ℕ. ex_tac): = x

пример: ex4 = 5: = rfl
 

3.4. Основные типы данных и утверждения

Основная библиотека содержит ряд основных типов данных, таких как натуральные числа ( или nat ), целые числа (), логические значения ( bool ) и общие операции над ними, а также обычные логические кванторы и связки. Некоторые примеры приведены ниже. Список общих обозначений и их приоритетов можно найти в файле в основной библиотеке.п def неограниченный (f: ℕ → ℕ): Prop: = ∀ M, ∃ n, f n ≥ M

3.5. Конструкторы, проекции и сопоставление

Основа компании

Lean, исчисление индуктивных конструкций , поддерживает декларацию индуктивных типов . Такие типы могут иметь любое количество конструкторов и связанный с ним элиминатор (или рекурсор ). Индуктивные типы с одним конструктором, известные как структуры , имеют выступов .Полный синтаксис индуктивных типов описан в главе 4, но здесь мы опишем некоторые синтаксические элементы, облегчающие их использование в выражениях.

Когда Lean может вывести тип выражения и это индуктивный тип с одним конструктором, тогда можно написать ⟨a1, a2, ..., an⟩ , чтобы применить конструктор без его имени. Например, ⟨a, b⟩ обозначает prod.mk a b в контексте, где выражение может быть выведено как пара, а ⟨h₁, h₂⟩ обозначает и.intro h₁ h₂ в контексте, когда выражение может быть выведено как союз. Обозначение будет автоматически вкладывать конструкции, поэтому ⟨a1, a2, a3⟩ интерпретируется как prod.mk a1 (prod.mk a2 a3) , когда ожидается, что выражение будет иметь тип вида α1 × α2 × α3 . (Последнее интерпретируется как α1 × (α2 × α3) , поскольку продукт ассоциируется справа.)

Аналогично можно использовать «точечную запись» для проекций: можно написать p.fst и p.snd для prod.fst p и prod.snd p , когда Lean может сделать вывод, что p является элементом продукта, а h. слева и h. справа для и. Слева h и и. Справа h , когда h — соединение.

Обозначение анонимного проектора может использоваться в более общем смысле для любых объектов, определенных в пространстве имен (см. Главу 5). Например, если l имеет тип list α , то l.map f сокращает list.map f l , в котором l помещается в позицию первого аргумента, где list.map ожидает список .

Наконец, для типов данных с одним конструктором один разрушает элемент путем сопоставления с образцом с использованием , пусть и предполагают конструкции , как в примерах ниже. Внутренне они интерпретируются с использованием конструкции match , которая, в свою очередь, компилируется для исключения для индуктивного типа, как описано в главе 4.2) пример (p q: Prop): p ∧ q → q ∧ p: = λ h, ⟨h. right, h.left⟩ def swap_pair ‘(p: α × β): β × α: = let (x, y): = p в (y, x) теорема swap_conj ‘{a b: Prop} (h: a ∧ b): b ∧ a: = пусть ⟨ha, hb⟩: = h в ⟨hb, ha⟩ def swap_pair »: α × β → β × α: = λ ⟨x, y⟩, (у, х) теорема swap_conj » {a b: Prop}: a ∧ b → b ∧ a: = Предположим, что ⟨ha, hb⟩, ⟨hb, ha⟩

3.6. Структурированные доказательства

Синтаксический сахар предназначен для написания структурированных доказательств:

  • предположим, что h: p, t — сахар для λ h: p, t
  • имеют h: p, от s, t — сахар для (λ h: p, t) s
  • достаточно h: p, из s, t — сахар для (λ h: p, s) t
  • показать п, т сахар для (т: п)

Как и в случае λ , несколько переменных могут быть связаны с предположением , а типы могут быть опущены, когда они могут быть выведены методом бережливого производства.Lean также позволяет синтаксису принять: p, t , что дает предположению имя , это в локальном контексте. Точно так же Lean распознает варианты , имеющие p, из s, t и , достаточно p, из s, t , которые используют имя это для новой гипотезы.

Обозначение ‹p› является обозначением для (по предположению: p) , и поэтому может использоваться для применения гипотез в локальном контексте.

Как указано в Разделе 3.5, анонимные конструкторы и проекции и синтаксис соответствия могут использоваться в доказательствах так же, как в выражениях, обозначающих данные.

 пример (p q r: Prop): p → (q ∧ r) → p ∧ q: =
Предположим, что h₁: p,
предположим, что h₂: q ∧ r,
имеют h₃: q, от и. слева h₂,
показать p ∧ q, из and.intro h₁ h₃

пример (p q r: Prop): p → (q ∧ r) → p ∧ q: =
Предположим: p,
Предположим: q ∧ r,
имеет q, от и. оставил это,
показать p ∧ q, от and.intro ‹p› это

пример (p q r: Prop): p → (q ∧ r) → p ∧ q: =
Предположим, что h₁: p,
предположим, что h₂: q ∧ r,
достаточно h₃: q, from и.вступление хо хо,
показать q, от и. слева h₂
 

Lean также поддерживает вычислительную среду, которая представлена ​​ключевым словом calc . Синтаксис следующий:

 расч.
   _0 'op_1'  _1 ':'  _1
    '...' 'op_2'  _2 ':'  _2
     ...
    '...' 'op_n'  _n ':'  _n
 

Каждый _i является доказательством для _ {i-1} op_i _i .

Вот пример:

 переменных (a b c d e: ℕ)
переменная h2: a = b
переменная h3: b = c + 1
переменная h4: c = d
переменная h5: e = 1 + d

Теорема T: a = e: =
вычисление
  а = b: h2
    ... = c + 1: h3
    ... = d + 1: congr_arg _ h4
    ... = 1 + d: add_comm d (1: ℕ)
    ... = e: eq.symm h5
 

Стиль написания доказательств наиболее эффективен, когда он используется в сочетании с тактиками simp и rewrite .

3.7. Расчет

Два выражения, которые различаются до переименования связанных переменных, называются α-эквивалентом и рассматриваются Lean как синтаксически эквивалентные.

Каждое выражение в Lean имеет естественную вычислительную интерпретацию, если только оно не включает классические элементы, блокирующие вычисления, как описано в следующем разделе. Система распознает следующие понятия редукции :

  • β-редукция : Выражение (λ x, t) s β-уменьшает до t [s / x] , то есть результат замены x на s в t .
  • ζ-редукция : Выражение let x: = s в t ζ-сокращается до t [s / x] .
  • δ-уменьшение : Если c — определенная константа с определением t , то c δ-уменьшается до t .
  • ι-редукция : Когда функция, определенная рекурсией для индуктивного типа, применяется к элементу, заданному явным конструктором, результат ι-сокращается до указанного значения функции, как описано в разделе 4.4.

Отношение приведения является переходным, то есть с уменьшается до с и t уменьшается до t , затем st уменьшается до с t , λ x , s уменьшается до λ x, s ' и т. д. Если s и t сводятся к общему термину, они считаются , по определению равными . Определяющее равенство определяется как наименьшее отношение эквивалентности, которое удовлетворяет всем этим свойствам, а также включает α-эквивалентность и следующие два отношения:

  • η-эквивалент : Выражение (λx, t x) η-эквивалентно t , при условии, что x не встречается в t .
  • доказательство несоответствия : Если p: Prop , s: p и t: p , то s и t считаются эквивалентными.

Этот последний факт отражает интуицию, согласно которой, как только мы доказали предложение p , нас волнует только то, что оно было доказано; доказательство не более чем свидетельство того факта, что p истинно.

Дефинициональное равенство — это сильное понятие равенства ценностей.Логические основы бережливого производства разрешают рассматривать одинаковые по определению термины как одинаковые при проверке того, правильно ли типизирован термин и / или что он имеет заданный тип.

Считается, что редукционное отношение сильно нормализует, то есть каждая последовательность редукций, применяемых к члену, в конечном итоге завершается. Свойство гарантирует, что алгоритм проверки типов Lean завершится, по крайней мере, в принципе. Непротиворечивость Lean и его надежность с точки зрения теоретико-множественной семантики не зависят ни от одного из этих свойств.

Lean предоставляет две команды для вычислений с выражениями:

  • #reduce t : используйте процедуры проверки типа ядра для выполнения сокращений на t до тех пор, пока сокращения больше не станут возможными, и покажите результат
  • #eval t : оценить t , используя быстрый оценщик байт-кода, и показать результат

Каждое вычислимое определение в Lean компилируется в байт-код во время определения. Оценка байт-кода более либеральна, чем оценка ядра: типы и вся предполагаемая информация стираются, а функции оцениваются с использованием виртуальной машины на основе стека.В результате #eval более эффективен, чем #reduce, и может использоваться для выполнения сложных программ. Напротив, #reduce спроектирован так, чтобы быть маленьким и надежным, а также производить термины с правильным типом на каждом этапе. Байт-код никогда не используется при проверке типов, поэтому с точки зрения надежности и согласованности только сокращение ядра является частью надежной вычислительной базы.

 # уменьшить (λ x, x + 3) 5
#eval (λ x, x + 3) 5

#reduce let x: = 5 in x + 3
#eval let x: = 5 in x + 3

def f x: = x + 3

#reduce f 5
#eval f 5

#reduce @nat.rec (λ n, ℕ) (0: ℕ)
                 (λ n recval: ℕ, recval + n + 1) (5: ℕ)
#eval @ nat.rec (λ n, ℕ) (0: ℕ)
                 (λ n recval: ℕ, recval + n + 1) (5: ℕ)

def g: ℕ → ℕ
| 0: = 0
| (n + 1): = g n + n + 1

#reduce g 5
#eval g 5

#eval g 50000

пример: (λ x, x + 3) 5 = 8: = rfl
пример: (λ x, f x) = f: = rfl
пример (p: Prop) (h₁ h₂: p): h₁ = h₂: = rfl
 

Примечание: комбинация доказательства нерелевантности и исключения одиночки Prop в ι-редукции делает идеальную версию дефиниционного равенства, как описано выше, неразрешимой.Процедура Lean для проверки дефиниционного равенства является лишь приближением к идеалу. Это не транзитивно, как показано в приведенном ниже примере. Еще раз, это не ставит под угрозу последовательность или надежность Lean; это только означает, что бережливое производство более консервативно в том, что касается терминов, которые он распознает как хорошо типизированные, и это не вызывает проблем на практике. Устранение синглтонов будет более подробно описано в разделе 4.4.

 def R (x y: unit): = false
def accrec: = @ accrec unit R (λ_, unit) (λ _ a ih, ()) ()
пример (h): accrec h = accrec (соотв.intro _ (λ y, согласно inv h)): =
              rfl
пример (h): accrec (accrec (acc.intro _ (λ y, acc.inv h)) = (): = rfl
пример (h): accrec h = (): = извините - rfl не работает
 

3.8. Аксиомы

Базовая структура Lean состоит из:

  • юниверсы типов и типы зависимых функций, как описано выше
  • индуктивных определений, как описано в разделах 4.4 и 4.5.

Кроме того, основная библиотека определяет (и доверяет) следующие аксиоматические расширения:

  • пропозициональная протяженность:

     аксиома propext {a b: Prop}: (a ↔ b) → a = b
     
  • частных:

     вселенных u v
    
    константа quot: Π {α: Sort u}, (α → α → Prop) → Sort u
    
    постоянная кв.mk: Π {α: Sort u} (r: α → α → Prop),
                         α → quot г
    
    аксиома quot.ind: ∀ {α: Sort u} {r: α → α → Prop}
                           {β: quot r → Prop},
                         (∀ a, β (quot.mk r a)) →
                           ∀ (q: quot г), β q
    
    константа quot.lift: Π {α: Sort u} {r: α → α → Prop}
                           {β: Сортировка u} (f: α → β),
                         (∀ a b, r a b → f a = f b) → quot r → β
    
    аксиома quot.sound: ∀ {α: Тип u} {r: α → α → Prop}
                           {a b: α},
                         r a b → quot.mk r a = quot.mk r b
     

    quot r представляет собой частное α на наименьшее отношение эквивалентности, содержащее r . quot.mk и quot.lift удовлетворяют следующему правилу расчета:

     quot.подъемник f h (quot.mk r a) = f a
     
  • выбор:

     выбор аксиомы {α: Sort u}: непусто α → α
     

    Здесь непустой α определяется следующим образом:

     класс индуктивный непустой (α: Sort u): Prop
    | intro: α → непусто
     

    Эквивалент ∃ x: α, истинный .

Фактор-конструкция подразумевает расширяемость функции. Принцип выбор в сочетании с другими делает аксиоматическую основу классической; в частности, это подразумевает закон исключенного третьего и пропозициональную разрешимость. Функции, которые используют вариант для создания данных, несовместимы с вычислительной интерпретацией и не создают байт-код. Их нужно объявить невычислимыми .

Для целей метапрограммирования Lean также позволяет определять объекты, которые находятся за пределами объектного языка.Они обозначаются ключевым словом meta , как описано в главе 7.

Редактор выражений

Справка по выражениям предлагает описание и примеры всех функций, доступных в языке выражений UiPath Process Mining . Справка содержит поле поиска для поиска функций, соответствующих введенной вами строке поиска; ищутся как названия функций, так и содержание справки. См. Пример на иллюстрации ниже.

📘

Примечание

Щелкните OK или дважды щелкните имя функции в диалоговом окне Expression Help , чтобы использовать функцию в диалоговом окне Edit Expression Attribute .

В Expression Language выражения могут быть следующих типов.

  • логический
  • Валюта
  • Дата
  • Продолжительность
  • Целое число
  • В процентах
  • Время
  • двойной
  • Текст
  • DateTime

Каждое выражение оценивается по одному из этих типов. Результат выражения должен быть одного типа для каждой записи.

Вы можете автоматически заполнять выражения, нажимая Ctrl + пробел при вводе текста.

Некоторые функции и операторы в языке выражений автоматически преобразуют свои аргументы в один и тот же тип. Например, оператор «плюс» («+») между текстовым значением и целым значением приведет к преобразованию целого числа в текстовое значение до их объединения.

Явное преобразование значения в другой тип может быть выполнено с помощью соответствующей функции приведения типа ( boolean () , integer () , double () , currency () , процент () , текст () , date () , time () , datetime () , duration () ).

📘

Примечание

Целое число можно преобразовать в Double , но преобразование значения Text в DateTime требует, чтобы входное значение было в определенном формате; он должен соответствовать настройкам формата DateTime для приложения.

В редакторе выражений элементы выражения выделяются в соответствии со следующим синтаксисом.

Кроме того, комментарии могут быть добавлены в диалоговом окне Редактировать атрибут выражения .

При написании выражения в диалоговом окне Изменить атрибут выражения отображается обратная связь, если выражение неверно. Например, когда функции не используются должным образом или когда разные типы смешиваются, когда это не разрешено. См. Иллюстрацию ниже.

Квадратный красный значок указывает на то, что строка содержит ошибку. Комментарий на панели результатов предполагает, что закрывающая скобка ожидается после отображения открывающей скобки.

Написать ответ

Ваш адрес email не будет опубликован. Обязательные поля помечены *